Gene/Protein
Disease
Symptom
Drug
Enzyme
Compound
Pivot Concepts:
Gene/Protein
Disease
Symptom
Drug
Enzyme
Compound
Target Concepts:
Gene/Protein
Disease
Symptom
Drug
Enzyme
Compound
Query: UNIPROT:P04637 (
p53
)
77,613
document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)
In this work we have explored the use of adenoviral vectors for the purging of cancer cells from hematopoietic stem cell (HSC) autografts. We showed that a recombinant adenovirus expressing the herpes simplex-1 thymidine kinase gene (AD-tk) plus ganciclovir (GCV) killed HELA cells more effectively than did GCV alone. HELA cells were then mixed with human HSCs and exposed to AD-tk/GCV. AD-tk/GCV reduced the number of HELA colonies to 4% of control values, with no detectable reduction in the hematopoietic progenitor, colony forming unit-granulocyte/monocyte (CFU-GM). Similar studies of the JB6 non-
Hodgkins lymphoma
cell line showed a reduction to 5% of controls; studies of MCF-7, a breast carcinoma cell line, showed a reduction to 30% of controls, with no CFU-GM toxicity. Thus, AD-tk mediated selective killing of contaminating tumor cells. We also evaluated a recombinant adenovirus encoding the tumor suppressor gene
p53
(AD-p53). AD-
p53
was able to selectively kill all three cell lines (reducing tumor colonies approximately 100-fold) without any toxicity to CFU-GM. Although both AD-tk/GCV and AD-
p53
were effective in these experiments, AD-
p53
seemed to be more potent. Adenoviral vectors show promise for selectively targeting cancer cells that contaminate HSC autografts.
...
PMID:Selective elimination (purging) of contaminating malignant cells from hematopoietic stem cell autografts using recombinant adenovirus. 885 51
Retinoblastoma (Rb) tumour-suppressor protein plays a critical role in cell cycle control. Rb inactivation is a frequent phenomenon in tumours of different cell lineages, in which the absence of Rb protein has been considered to be a marker of Rb disregulation. We used modern immunohistochemical techniques to study the expression of Rb protein in a large series of 130 patients with
Hodgkin's disease
. Simultaneously, Western blot was used to analyse a more restricted group (12 patients) to confirm the immunohistochemical results and to clarify the phosphorylation status of Rb protein. As the level of Rb expression varied according to cell cycle stage, we also performed immunostaining for Ki67, a protein present in proliferating cells. To make comparison possible, we first characterised the amount and phosphorylation status of Rb protein in reactive lymphoid tissue and phytohaemagglutinin (PHA)-stimulated lymphocytes. The presence of
p53
in Sternberg-Reed cells was also included in the study, as both proteins (
p53
and Rb) have been found to be closely associated in cell cycle control. PHA-stimulated peripheral blood lymphocytes showed a parallel increase in Rb and cell cycle progression, together with progressive Rb phosphorylation. In reactive lymphoid tissue there was also a clear correlation between Rb expression and the Ki67 proliferation index (R = 0.96, P = 0.038). When analysing
Hodgkin's disease
samples, a clear difference emerges between cases of nodular lymphocyte predominance, which preserve the relationship between Rb and Ki67 expression (r = 0.8727, P = 0.000), and classical forms of
Hodgkin's disease
(nodular sclerosis and mixed cellularity), which display a strong deviation from this pattern. Two main anomalies were found: (1) One group of 21/130 cases with partial or total loss of Rb protein expression, which could reflect the existence of genetic alterations, or an altered transcriptional or translational regulation of Rb gene. (2) Another group with an abnormally high Rb/Ki67 ratio, which could support conflicting interpretations: (i) excess Rb protein for controlling cell cycle progression; or (ii) adhesion of Rb protein to other cellular or viral proteins, such as
p53
and MDM2. The results of this study indicate an anomalous pattern of expression of Rb in classical forms of
Hodgkin's disease
, and suggest the possibility of undertaking functional studies (E1A adhesion, p16 expression) with the aim of better characterising the status of Rb protein, and correlating these findings with clinical course in
Hodgkin's disease
patients.
...
PMID:Anomalous retinoblastoma protein expression in Sternberg-Reed cells in Hodgkin's disease: a comparative study with p53 and Ki67 expression. 885 74
Although numerous studies have demonstrated increased expression of
p53 protein
in the Reed-Sternberg cells of
Hodgkin's disease
, little data exist as to whether mutations of the
p53
gene is a common occurrence in this neoplasm. Using a microdissection technique coupled with PCR, single-strand conformation analysis, and DNA sequencing, we studied 23 cases of
Hodgkin's disease
for mutations within exons 5 to 8 of the
p53
gene. We found seven mutations within six cases; six were missense mutations. An identical missense mutation was found in three cases (codon 243, methionine to isoleucine), and another identical missense mutation was found in an additional two cases (codon 204, glutamic acid to lysine). Verification of the mutations was accomplished either by direct Southern blotting of PCR-amplified
p53
exon products from re-extracted DNA or by hybridization of cloned PCR-amplified
p53
exon products from re-extracted DNA with a mutant-specific oligonucleotide. There was no good correlation between the presence of
p53
mutations and the level of
p53 protein
expression, which was found to be overexpressed in all cases, the level of MDM2 protein expression, or the proliferation rate as determined by K-67 antibody. None of the cases with
p53
mutation had evidence of Epstein-Barr virus within the Reed-Sternberg cells, as compared with 7 of 17 of the other cases (p < 0.06). These results suggest that
p53
mutation may represent an important mechanism in the pathogenesis of
Hodgkin's disease
, and this mechanism may be independent of Epstein-Barr virus.
...
PMID:p53 mutations in Hodgkin's disease. 887 83
The majority of low grade non-
Hodgkin
's follicular lymphoma undergo clinical progression to intermediate and high grade lymphoma, but the molecular mechanisms involved in this transformation are not yet well understood. In this article, we describe the case of a 66 year old man with follicular non-Hodgkin's lymphoma (NHL), in whom a centroblastic leukaemic transformation led to death in six months, despite a transient period of remission. At the time of transformation, cytogenetic analysis revealed the original coexistence of t(14;18)(q32;q21) and t(8;22)(q24;q11). These results were confirmed by fluorescent in situ hybridization, while molecular analysis showed a BCL2-JH rearrangement but failed to detect a c-myc rearrangement or any additional
p53
mutation. Our observations would therefore suggest other mechanisms to be involved in the transformation of follicular NHL.
...
PMID:Transformation of follicular lymphoma with both t(14;18) and t(8;22). 890 4
p21WAF1 (wild-type p53-activated fragment 1) is involved in the control of mammalian cell cycle through the binding and inhibition of cyclin-dependent kinases (Cdk). Because the product of WAF1 gene is a potent downstream effector of the
p53
tumor-suppressor gene function, its pattern of cellular expression might correlate with nuclear accumulation of
p53
-encoded protein and/or
p53
gene mutations occurring in malignant lymphomas. To investigate this issue, we analyzed immunohistochemically the expression of
p53
and p21WAF1 proteins in tissue involved by non-
Hodgkin
's lymphomas (NHLs;253 cases) of various histologic types. In a proportion of them (80 cases), we also investigated the possible presence of
p53
gene mutations using single-strand conformation polymorphism analysis and direct DNA sequencing. The absence of both p21WAF1 and
p53
proteins was observed in 147 of 217 cases (67.7%) among CD30-NHL and in only 8 of 36 (22.2%) CD30+cases, which were mostly anaplastic large-cell lymphomas. A consistent number (> 10%) of p21WAF1-expressing cells was shown in 48 of 253 (18.9%) NHL cases, with a higher incidence in CD30+cases (25/36 [69.4%]), which mostly (21/36) coexpressed
p53
. These latter cases were characterized by a germline configuration of the
p53
gene. In 50 of 253 NHL samples (19.7%), 47 of which (21.6%) belong to the CD30-group, neoplastic cells were p53+/p21-. In all of these cases, the p53+cells accounted for more than 50% of neoplastic cells, up to 100%. Point mutations of
p53
gene were solely observed in all investigated cases with this latter phenotype. Our findings strongly suggest that the combined immunohistochemical evaluation of
p53
and p21WAF1 is a valuable means of assessing the functional status of the
p53
tumor-suppressor gene product in NHL with potential application in the monitorage and prognostication of individual cases.
...
PMID:p21/WAF1 cyclin-kinase inhibitor expression in non-Hodgkin's lymphomas: a potential marker of p53 tumor-suppressor gene function. 891 68
The expression of
p53
and mdm-2 proteins was analysed in parrafin sections from 39 cases of
Hodgkin's disease
(HD) and compared to the presence of Epstein-Barr Virus (EBV).
P53
protein was found in
Hodgkin
and Reed-Sternberg (HRS) cells in 12/39 cases. Mdm-2 protein was found in HRS cells in 10/39 cases. EBV-encoded EBER1-2 mRNAs and LMP-1 protein expression were found in HRS cells in 16/39 cases. In view of the LMP-1 oncogenic potential in vitro, these findings suggest that EBV may be involved in the pathogenesis of a proportion of HD cases. The coexpression of mdm-2 and
p53
proteins was found in HRS cells in 10 cases, whereas in 27 cases neither was identified and in 2 cases there was no coexpression of mdm-2/
p53
. The simultaneous
p53
/mdm-2 protein expression, in view of previous findings which showed that most cases of HD display no
p53
gene mutations, suggests that mdm-2 protein expression may be one of the factors responsible for the stabilisation of
p53 protein
in these cases. This could be important, in the pathogenesis of these cases of HD, since mdm-2 may deregulate the
p53
dependent growth suppressive pathway. Mdm-2-/ p53+ protein expression may reflect the stabilisation of
p53 protein
by proteins other than mdm-2, mutations in the
p53
gene making it unable to activate mdm-2, or the deregulation of the mdm-2 gene. No relationship was found between the presence of EBV and the expression of
p53
and/or mdm-2 proteins.
...
PMID:Expression of p53 and mdm-2 proteins in Hodgkin's Disease. Absence of correlation with the presence of Epstein-Barr virus. 891 90
The mdm-2 protein is a 90-kD protein that forms a complex with the
p53 protein
, enabling cells from some human neoplasms to overcome the growth-suppressing activity of
p53
. Most non-
Hodgkin
's lymphomas lack
p53
mutations, and the mechanism of inactivation of tumor suppressive function remains obscure. To assess the role of mdm-2 in lymphomagenesis, 22 cases were evaluated for mdm-2 gene amplification or rearrangement in Southern blots. Localization of the mdm-2 protein was performed on cryostat sections and compared with expression of the
p53
gene product. No case exhibited mdm-2 gene amplification or rearrangement, but overexpression of nuclear mdm-2 gene protein product was found in three of six diffuse large cell (B-cell immunoblastic) lymphomas (30-70% of the tumor cells stained). The mdm-2 protein was absent from low- and intermediate-grade lymphomas with the exception of a few cells (5% or less) in four cases. The mdm-2-positive cases stained negative for
p53
. Southern blot analysis showed that samples overexpressing mdm-2 did not have amplification or rearrangement of the gene. In summary, amplification of the mdm-2 gene does not appear to play a prominent role in the pathogenesis of non-
Hodgkin
's lymphomas, although overexpression of the protein gene product occurs, particularly in high-grade neoplasms.
...
PMID:mdm-2 oncogene expression in non-Hodgkin's lymphomas. 891 43
Hodgkin's disease
(HD) is characterized by the presence of the typical, clonal malignant
Hodgkin
and Reed-Sternberg (H-RS) cells in a hyperplastic background of normal reactive lymphocytes, plasma cells, histiocytes, neutrophils, eosinophils and stromal cells. The neoplastic nature of HD is based on aggressive clinical progression, presence of the proliferating and atypical H-RS cells, aneuploidy and cellular clonality. Immunophenotypical studies have demonstrated frequent expression of lymphoid "activation markers' including CD15, CD25, CD30, CD40, CD54, CD70, CD71, CD80, CD86 and MHC class II and less frequent expression of T- or B-cell-associated antigens by the neoplastic H-RS cells. The clonality of H-RS cells is demonstrated by clonal EBV integration, clonal cytogenetic abnormalities including
p53
mutations and clonal immunoglobulin rearrangements in some HD cases. There is involvement of diverse molecules with oncogenic potential, including presence of viruses (Epstein-Barr virus and human herpes virus-6) and/or oncogenes/tumour suppressor genes (bcl-2/bcl-x,
p53
/MDM-2, c-myc, c-fms, N-ras, lck). The histopathological presentation and characteristic clinical features of HD correlate with an unbalanced production of multiple cytokines and define HD as a tumour of cytokine-producing cells. The proportion of malignant H-RS cells to reactive cellular components and fibrosis is dependent on the production of particular cytokines and allows subtyping of HD cases. The combined use of immunohistochemical, biochemical and molecular techniques has thus allowed recognition that HD represents more than one clinico-pathological entity with different types of H-RS cells. The defined mechanism for the biological nature, origin and oncogenesis of H-RS cells remains not fully understood, but is susceptible to further analysis using modern technology.
...
PMID:Pathophysiology of Hodgkin's disease: functional and molecular aspects. 892 38
Mutations in the
p53
tumour suppressor gene are the most common genetic alteration found in human cancers. Most of them are accompanied by stabilization of the protein, which renders it detectable through immunohistochemical techniques. Although
p53
expression is a very common finding in
Hodgkin's disease
(HD), the status of the
p53
gene is scarcely known, due to the difficulty in sequencing this gene in a lesion in which tumour cells are thought to constitute a very minor subpopulation, diluted in a background of supposedly benign cells. The pattern of expression of two downstream
p53
proteins (MDM2 and p21 WAF1/CIP1, was studied as an indirect way of assessing
p53
gene status. MDM2 is a wild-p53 inducible protein which may form a complex with
p53
, abrogating its function, as has been found in human sarcomas and other malignancies. p21WAF1/CIP1 is another protein inducible by wild-type
p53
, involved in inhibiting cell-cycle progression, through binding to cyclin/cyclin-dependent-kinase complexes. MDM2 and p21WAF1/CIP1 immunostaining was detected in all the cases analysed, independently of histological type, and were mainly present in Sternberg-Reed and
Hodgkin
(H & SR) cells. These immunohistochemical results were confirmed by Western blotting. To study the cause of MDM2 protein accumulation, MDM2 mRNA expression was also investigated by reverse transcription polymerase chain reaction (RT-PCR). The results show the presence of MDM2 transcripts in all cases of HD, albeit at lower levels than those found in reactive lymphoid tissue. These results seem to support the hypothesis that
p53
is transcriptionally active in at least some of the H & SR cells in HD, and is able to induce MDM2 and p21WAF1/CIP1 protein expression.
...
PMID:MDM2 and p21WAF1/CIP1, wild-type p53-induced proteins, are regularly expressed by Sternberg-Reed cells in Hodgkin's disease. 894 16
Human cDNA and genomic DNA encoding cyclin G were cloned and analyzed. The amino acid sequence of cyclin G is well conserved among mammals. Human cyclin G (295 amino acids) has one extra Thr at residue 6 compared with rat and mouse cyclin G (294 amino acids). The genomic DNA for human cyclin G consists of six exons, and in the first intron, one distinct putative binding site for the
p53 tumor suppressor
gene product (GCACAAGCCCAGGCTAGTCC) was detected. We performed chromosome mapping utilizing the fluorescence in situ hybridization (FISH) technique using both cDNA and genomic DNA for cyclin G. FISH localizes human cyclin G to the 5q32-q34 region. In the vicinity of the chromosomal location of human cyclin G, four cases of chromosomal translocations in human hematopoietic tumors have been reported, such as a subgroup of chronic myelomonocytic leukemia, non-
Hodgkin lymphoma
, and acute lymphocytic leukemia. It is therefore important to examine whether chromosomal translocations around this region cause aberrant cyclin G expression in a manner that is causally related to leukemia.
...
PMID:Structure and chromosomal assignment of the human cyclin G gene. 895 86
<< Previous
1
2
3
4
5
6
7
8
9
10
Next >>