Gene/Protein Disease Symptom Drug Enzyme Compound
Pivot Concepts:   Target Concepts:
Query: UNIPROT:P01034 (cystatin C)
 3,397 document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)

The nucleotide sequences of the two glutamine tRNA species in Escherichia coli K12 have been determined. Sufficient data was obtained to order unambiguously the products of complete RNase digestion of tRNA2Gln, and all but one oligonucleotide from tRNA1Gln. The sequence of tRNA1Gln was established by analogy with tRNA1Gln, as the two tRNAs are very similar, differing by only 7 residues out of 75. tRNA1Gln has the anticodon NUG, where N is a modified nucleotide which is likely to be a derivative of 2-thiouridine, and is specific for the codon CAA. tRNA1Gln has the anticodon CUG, and is specific for the codon CAG (Folk, W. R., and Yaniv, M. (1972) Nature 237, 165). The complete sequences of the tRNAGln species are: See journal for formula (Unique residues are enclosed in parentheses, with the residue in tRNA1Gln above that in tRNA2Gln.).
 ...
PMID:The nucleotide sequences of the two glutamine transfer ribonucleic acids from Escherichia coli. 16 64

The nucleotide sequence of T4 species I RNA, one of several stable RNA's specifically coded for by bacteriophage T4, has been determined using 32-P-labeled material from T4-infected cultures of Escherichia coli. The purified RNA species which has been sequenced has been shown to hybridize well to T4 DNA (Wilson J.H., Kim, J.S., and Abelson, J.N. (1972) J. Mol. Biol. 71, 547-556). The sequence is: pCGAUUCGAGGAAAUAUCUUUGCCGUAAGCCGAGUAGCGUUUUUGACGGAACGUUCGGAUAUGGUUGAGAUAUGGCCUUUUAAAAUAUUGAGUAGCGUCAACUACUUAAUAACCGGGUUCGAAUCCCGGCGUUUCGU-CAA-OHACA-OH. Species I RNA which is 140 nucleotides long is also found to occur in shorter versions with 135 to 136 nucleotides which terminate with a 3'-phosphate. The molecule can be arranged in a secondary structure which shows some striking similarities to the classic cloverleaf pattern of a tRNA. The molecule is specifically cleaved by an E. coli nuclease into three segments by cleavage at a double-stranded region in the molecule. The function of species I RNA is unknown, but evidence presented elsewhere (Paddock, G.V., and Abelson, J. (1975) J. Biol. Chem. 250, 4207-4219) indicates that the gene for this RNA molecule has been preserved in evolution. The position of a mutation within species I RNA has been determined. This mutation results in incorrect processing of the RNA and lower relative yields of the RNA are present.
 ...
PMID:Nucleotide sequence determination of bacteriophage T4 species I ribonucleic acid. 109 86

The role of the anticodon and discriminator base in aminoacylation of tRNAs with tryptophan has been explored using a recently developed in vivo assay based on initiation of protein synthesis by mischarged mutants of the Escherichia coli initiator tRNA. Substitution of the methionine anticodon CAU with the tryptophan anticodon CCA caused tRNA(fMet) to be aminoacylated with both methionine and tryptophan in vivo, as determined by analysis of the amino acids inserted by the mutant tRNA at the translational start site of a reporter protein containing a tryptophan initiation codon. Conversion of the discriminator base of tRNA(CCA)fMet from A73 to G73, the base present in tRNA(Trp), eliminated the in vivo methionine acceptor activity of the tRNA and resulted in complete charging with tryptophan. Single base changes in the anticodon of tRNA(CCA)fMet containing G73 from CCA to UCA, GCA, CAA, and CCG (changes underlined) essentially abolished tryptophan insertion, showing that all three anticodon bases specify the tryptophan identity of the tRNA. The important role of G73 in tryptophan identity was confirmed using mutants of an opal suppressor derivative of tRNA(Trp). Substitution of G73 with A73, C73, or U73 resulted in a large loss of the ability of the tRNA to suppress an opal stop codon in a reporter protein. Base pair substitutions at the first three positions of the acceptor stem of the suppressor tRNA caused 2-12-fold reductions in the efficiency of suppression without loss of specificity for aminoacylation of the tRNA with tryptophan.(ABSTRACT TRUNCATED AT 250 WORDS)
 ...
PMID:Conversion of a methionine initiator tRNA into a tryptophan-inserting elongator tRNA in vivo. 155 14

Expression of the RNA replicase domain of tobacco mosaic virus (TMV) and certain protein-coding regions in other plant viruses, is mediated by translational readthrough of a leaky UAG stop codon. It has been proposed that normal tobacco tyrosine tRNAs are able to read the UAG codon of TMV by non-conventional base-pairing but recent findings that stop codons can also be bypassed as a result of extended translocational shifts (tRNA hopping) have encouraged a re-examination. In light of the alternatives, we investigated the sequences flanking the leaky UAG codon using an in vivo assay in which bypass of the stop codon is coupled to the transient expression of beta-glucuronidase (GUS) reporter genes in tobacco protoplasts. Analysis of GUS constructions in which codons flanking the stop were altered allowed definition of the minimal sequence required for read through as UAG-CAA-UUA. The effects of all possible single-base mutations in the codons flanking the stop indicated that 3' contexts of the form CAR-YYA confer leakiness and that the 3' context permits read through of UAA and UGA stop codons as well as UAG. Our studies demonstrate a major role for the 3' context in the read through process and do not support a model in which teh UAG is bypassed exclusively as a result of anticodon-codon interactions. No evidence for tRNA hopping was obtained. The 3' context apparently represents a unique sequence element that affects translation termination.
 ...
PMID:The signal for a leaky UAG stop codon in several plant viruses includes the two downstream codons. 201 Sep 14

Recently, it was shown that wild-type glutamine tRNAs in yeast cause low-level nonsense suppression that can be enhanced by increasing glutamine tRNA gene copy number. In order to investigate glutamine tRNA behavior further, anticodon mutations that confer nonsense suppression were identified in yeast sup70 gene, which codes for glutamine tRNA(CAG). In this study we show that suppressors derived by mutation severely limit growth such that suppressor-bearing spores germinate but arrest cell division at approximately the 50 cell stage. Analysis of a sup70 deletion was used to establish that growth limitation results from loss of wild-type glutamine tRNA(CAG) function. By exploiting the growth inhibition of sup70 alleles, some exceptional codon recognition properties of glutamine tRNAs were revealed. Our results indicate that amber suppressor glutamine tRNA(UAG) can translate 5'-CAG-3' glutamine codons with low efficiency in the presence of an A/C mismatch at the first position of the codon, suggesting that reading may occur at a low level by a two-out-of-three reading mechanism. In addition, when glutamine tRNA(CAA) is over-expressed in vivo, it translates 5'-CAG-3' codons using a mechanism that resembles prokaryotic-like U/G wobble, which normally does not occur in yeast. Our studies also suggest that the yeast glutamine tRNA suppressors could potentially be exploited to express ciliated protozoan genes that normally contain internal 5'-UAG-3' and 5'-UAA-3' codons.
 ...
PMID:Exceptional codon recognition by the glutamine tRNAs in Saccharomyces cerevisiae. 202 45

Introns in transfer RNA genes are rare in vertebrates. Until now, the only intron-containing human tRNA genes were believed to be those coding for tRNA(Tyr). All of these introns are inserted 3' to the anticodon position in these genes. We have designed polymerase chain reaction primers that can amplify all of the tRNA(Tyr) genes for cloning and sequencing by using the conserved portions of the gene coding for the structural part of the tRNA. Our preliminary results have revealed five tRNA(Tyr) genes, each of which contains a different intron. We used the same technique to amplify, clone, and sequence the human genes for tRNA(Leu)CAA. This has resulted in the discovery that this human tRNA gene family also has introns inserted 3' to the anticodon. This polymerase chain reaction technique is useful in detecting new families of intron-containing tRNA genes as well as identifying sequence variations in the introns of individual genes.
 ...
PMID:The discovery of new intron-containing human tRNA genes using the polymerase chain reaction. 237 82

In the presence of plant tRNAs the full-length translation product of alfalfa mosaic virus RNA 1 is produced in rabbit reticulocytes only at low mRNA concentration. At higher mRNA concentration translation is restricted to the 5' half of RNA 1. At high mRNA concentration the full-length product can be formed when additional plant tRNA and glutamine are supplied to the translation mixture. In contrast, in the presence of yeast or calf liver tRNA the translation pattern of alfalfa mosaic virus RNA 1 always results in the synthesis of the full-length product. Pulse-chase experiments in the presence of plant tRNAs show that the ribosomes pause at several positions in the 5' half of RNA 1. The pausing time is different at the different 'halting places'. Protein synthesis is resumed upon addition of glutamine, even when the addition is delayed for more than 3 h after the start of protein synthesis. Only one tRNA species, purified from wheat germ or tobacco, could promote full-length translation of RNA 1. This tRNA can be charged with glutamine. Analysis of the position of glutamine codons on RNA 1 shows a correlation between the positions of the CAA codons and the halting places of the ribosomes. The CAA codon (for any other codon) on its own cannot be responsible for the pausing of the ribosomes, since a variety of RNAs, known to contain all sense codons, are translated efficiently in rabbit reticulocyte lysates in the presence of plant tRNAs. Apparently other elements can restrict decoding of normal codons during protein chain elongation.
 ...
PMID:Ribosomes are stalled during in vitro translation of alfalfa mosaic virus RNA 1. 241 4

Continuing our investigation of the tRNA genes and gene products in Mycoplasma mycoides, we report the sequence of the gene for tRNALeu (CAA) as well as partial primary structures of the following tRNAs: Leu (CAA), Leu (UAG), Arg (UCU), Thr (AGU) and Ile (CAU). It is suggested that in M. mycoides, at least some of the family codon boxes are read by only one tRNA each, using an unconventional method which does not discriminate between the nucleotides in the third codon position. M. mycoides is the first free-living organism known to use an unconventional method of this kind.
 ...
PMID:Unconventional codon reading by Mycoplasma mycoides tRNAs as revealed by partial sequence analysis. 247 10

Mammalian cells contain two species of glutamine tRNAs, tRNA(CUGGIn) and tRNA(UmUGGIn). The later minor glutamine tRNA which has the UmUG anticodon sequence can recognize an UAG amber termination codon of natural mRNA in an in vitro translation system. Recognition of the UAG nonsense codon by mammalian tRNA(UmUGGIn) is facilitated by two wobble base-pairs at the first and third position of the anticodon. Such unorthodox interaction between the codon and the anticodon which is not in accordance with the wobble hypothesis or the two out of three reading mechanism has been shown only in the recognition of the UAG nonsense codon by natural suppressor tRNA such as yeast tRNA(SGIn) and bovine liver tRNA(CAGLeu). Due to such unique interaction with mRNA, the suppressor activity of mammalian glutamine tRNA(UmUGGIn) is weaker than that of tobacco tRNA(G psi ATyr), which is known to be a natural UAG suppressor tRNA in plants. Retrovirus infection followed by vegetative growth causes the selective and remarkable increase of the amount of UAG suppressor glutamine tRNA(UmUGGIn) in the virus-infected cells. The increased amount of tRNA(UmUGGIn) seems to be important not only for the sufficient production of a viral UAG readthrough protein, but also for the efficient translation of viral mRNAs, since tRNA(UmUGGIn) should read as efficiently the CAA glutamine codon which frequently appears in the viral genome. The increased level of tRNA(UmUGGIn) in virus-infected cells might be due to specific transcription activation of the tRNA gene for tRNA(UmUGGIn). The factor required for the transcription regulation of the suppressor tRNA gene, if it exists in virus infected cells, may not be the same as the factors TFIIIB, IIIC and IIID so far identified. If such a specific transcription factor exists, it would be interesting to characterize it and to elucidate the mechanism by which it is induced by infection with Mo-MuLV or HIV.
 ...
PMID:[Natural UAG suppressor glutamine tRNA in retrovirus infected cells]. 253 81

Ochre suppressor mutations induced by UV in the Escherichia coli glnU tRNA gene are CG to TA transitions at the first letter of the anticodon-encoding triplet, CAA. Premutational UV photoproducts at this site have long been known to exhibit an excision repair anomaly ("mutation frequency decline" or MFD), whereby postirradiation inhibition of protein synthesis enhances their excision and reduces suppressor mutation yields ten-fold. We sought to clarify the basis of this unique repair response by determining the spectrum of UV photoproducts on both strands of a 36 bp region of glnU which includes the anticodon-encoding triplet. We found that four different photolesions are produced within the 3 bp sequence corresponding to the tRNA anticodon: (i) on the transcribed strand, TC (6-4) photoproducts and TC cyclobutane dimers are formed in equal numbers at the site of the C to T transition, indicating that this site is a hotspot for the usually less frequent (6-4) photoproduct; (ii) on the nontranscribed strand, TT dimers are found opposite the second and third letters of the anticodon-encoding triplet, adjacent to the mutation site; and (iii) on the nontranscribed strand, an alkali-sensitive lesion other than a (6-4) photoproduct is formed, apparently at the G in the mutation site. We suggest that mutation frequency decline may reflect excision repair activity at closely spaced UV lesions on opposite strands, resulting in double-strand breaks and the death of potential mutants.
 ...
PMID:Ultraviolet photoproducts at the ochre suppressor mutation site in the glnU gene of Escherichia coli: relevance to "mutation frequency decline". 269 24


1 2 3 4 5 6 7 Next >>