Gene/Protein Disease Symptom Drug Enzyme Compound
Pivot Concepts:   Target Concepts:
Query: UNIPROT:P01034 (cystatin C)
 3,397 document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)

The nucleotide sequence of T4 species I RNA, one of several stable RNA's specifically coded for by bacteriophage T4, has been determined using 32-P-labeled material from T4-infected cultures of Escherichia coli. The purified RNA species which has been sequenced has been shown to hybridize well to T4 DNA (Wilson J.H., Kim, J.S., and Abelson, J.N. (1972) J. Mol. Biol. 71, 547-556). The sequence is: pCGAUUCGAGGAAAUAUCUUUGCCGUAAGCCGAGUAGCGUUUUUGACGGAACGUUCGGAUAUGGUUGAGAUAUGGCCUUUUAAAAUAUUGAGUAGCGUCAACUACUUAAUAACCGGGUUCGAAUCCCGGCGUUUCGU-CAA-OHACA-OH. Species I RNA which is 140 nucleotides long is also found to occur in shorter versions with 135 to 136 nucleotides which terminate with a 3'-phosphate. The molecule can be arranged in a secondary structure which shows some striking similarities to the classic cloverleaf pattern of a tRNA. The molecule is specifically cleaved by an E. coli nuclease into three segments by cleavage at a double-stranded region in the molecule. The function of species I RNA is unknown, but evidence presented elsewhere (Paddock, G.V., and Abelson, J. (1975) J. Biol. Chem. 250, 4207-4219) indicates that the gene for this RNA molecule has been preserved in evolution. The position of a mutation within species I RNA has been determined. This mutation results in incorrect processing of the RNA and lower relative yields of the RNA are present.
 ...
PMID:Nucleotide sequence determination of bacteriophage T4 species I ribonucleic acid. 109 86

As a result of examining regional-specific gene expression in the mouse epididymis, a novel cystatin-related epididymal specific (CRES) gene was identified. Substantial homology between the CRES gene and members of the cystatin family of cysteine proteinase inhibitors was observed at the amino acid level. This homology included the presence of four highly conserved cysteine residues in exact alignment with the cystatins as well as other regions of sequence characteristic of the cystatins. However, unlike the cystatins, the CRES gene does not contain specific highly conserved sequence motifs thought to be necessary for cysteine proteinase inhibitory activity. Also, in contrast to the ubiquitous expression of the cystatin C gene, Northern blot analysis and in situ hybridization demonstrated that the CRES gene is very restricted in its expression. The 0.75-kilobase CRES transcript is dramatically restricted to the very proximal caput region of the epididymis with 15- to 20-fold less expression in the testis and no expression detected in any of the other 24 tissues examined. In addition, the CRES transcript disappears 2-3 weeks after castration, suggesting a dependence on androgens. However, its expression remained undetectable even after the administration of testosterone or dihydrotestosterone. Unilateral castration also resulted in the disappearance of the CRES mRNA from the castrate epididymis, but not from the intact epididymis, suggesting that testicular factors or hormones other than androgens may be involved in the regulation of CRES gene expression. Therefore, the unique sequence of the CRES gene as well as its highly restricted expression and unusual regulation by the testis suggests that it has a very specialized role in the epididymis.
Mol Endocrinol 1992 Oct
PMID:The CRES gene: a unique testis-regulated gene related to the cystatin family is highly restricted in its expression to the proximal region of the mouse epididymis. 128 Mar 28

An alkaline unwinding assay was used to quantitate the induction of DNA strand breaks (DNA SB) in the livers of rats and mice treated in vivo, in rodent hepatocytes in primary culture, and in CCRF-CEM cells, a human lymphoblastic leukemia cell line, following treatment with tri- (TCA), di- (DCA), and mono- (MCA) chloroacetic acid and their corresponding aldehydes, tri- (chloral hydrate, CH), di- (DCAA) and mono- (CAA) chloroacetaldehyde. None of the chloroacetic acids induced DNA SB in the livers of rats at 4 hr following a single administration of 1-10 mmole/kg. TCA (10 mmole/kg) and DCA (5 and 10 mmole/kg) did produce a small amount of strand breakage in mice (7% at 4 hr) but not at 1 hr. N-nitrosodiethylamine (DENA), an established alkylating agent and a rodent hepatocarcinogen, produced DNA SB in the livers of both species. TCA, DCA, and MCA also failed to induce DNA strand breaks in splenocytes and epithelial cells derived from the stomach and duodenum of mice treated in vivo. None of the three chloroacetaldehydes induced DNA SB in either mouse or rat liver. The continuous exposure of mice to 5 g/L DCA in the drinking water for 7 and 14 days did not induce appreciable hepatic DNA SB (< 10% at 14 days), although peroxisome proliferation, as evidenced by an increased cyanide-insensitive palmitoyl CoA oxidase (PCO) activity, was stimulated to 490% (7 days) and 652% (14 days) of control. Under this protocol, DENA (0.1 g/L) produced DNA damage after both 7 days (73% of control) and 14 days (57% of control). Similarly, long-term exposure of rats (30 weeks) to 2 g/L DCA in the drinking water, a level that increased PCO activity to 364% of the control value, exhibited no DNA damage. Both the chloroacetic acids and the chloroacetaldehydes were ineffective in inducing DNA SB in cultured rat and mouse hepatocytes at concentrations below those that yielded cytotoxicity. The chloroacetic acids were also ineffective in the CCRF-CEM cells. However, two of the chloroaldehydes, DCAA and CAA, did induce DNA SB in the CCRF-CEM cells at concentrations that did not decrease the cell viability after 2 hr of treatment. Prior incubation of DCAA and CAA with a rat S9 liver homogenate eliminated much of the DNA damaging activity. These studies provide further evidence that the chloroacetic acids lack genotoxic activity not only in rodent liver, a tissue in that they induce tumors, but in a variety of other roden tissues and cultured cell types.(ABSTRACT TRUNCATED AT 400 WORDS)
Environ Mol Mutagen 1992
PMID:Analysis of DNA strand breaks induced in rodent liver in vivo, hepatocytes in primary culture, and a human cell line by chlorinated acetic acids and chlorinated acetaldehydes. 133 May 47

About 1800 sequences of gene promoters, enhancers and other types of regulatory elements (REG) have been statistically analysed for investigation of a role for enzymatic DNA methylation in prokaryotes, yeasts, plants, invertebrates, animal viruses, vertebrates and human. The frequencies and localizations of CG and CNG methylated sites and also the number of CG-->TG+CA transitions in different series of REGs have been studied. It was showed that the pro- and eukaryotic REGs with the exception of yeast and drosophila ones have higher CpG-suppression values than the main genome in the same species. About 40% of all the point substitutions in pro- and eukaryotic REGs were found in the CG and CNG methylated sites, that are "hot spots" for C-->T transitions. More than 30% of all analysed REGs have neither sites CG nor CNG and so they are not capable of methylation in vivo. The methylated sites have not been localized in any specific regions of promoters and other types of REGs nor in the flanking sequences of the same genes. Only part of the homological REG's sequences have CG and CNG methylated sites. Therefore the methylation of cytosine residues in any REGs may be not an obligatory condition for normal regulation of the REG activity in cells. Two main REG's families of different length were unexpectedly found in the study. The length of the first one is 9-12 n. and the second is 17-20 n. The families are about 60-80% of other REGs. The essential deficiency of cytosine residues and also triplets of CGG, CCG, CTG and CAG has been showed in the "sense" chain of the REGs. The chain has some abundance of TTG, CCA and CAA triplets. The REG's chains have a strong asymmetry in purine and pyrimidine contents and also in duplets TG and CA frequencies. It may be the result of different reparation effectivity of G-T pairs produced by 5-meC residues deamination in DNA complementary chains. Therefore cytosine methylation in REGs may strongly destabilize the structure, accelerate its divergence in evolution, and disturb the REGs binding with protein factors regulating activity of the genes. The results showed that a function of DNA enzymatic methylation may be hardly realized through the modification of gene regulatory elements.
Mol Biol (Mosk)
PMID:[Enzymatic methylation of regulatory elements in controlling the activity of genes from various groups of organisms]. 133 47

Hereditary cerebral hemorrhage with amyloidosis, Dutch type (HCHWA-D) (or familial cerebral amyloid angiopathy) and familial Alzheimer's disease (FAD) share several properties. Both are autosomal dominant forms of cerebral amyloidosis characterized by beta-amyloid (A beta) deposition. In HCHWA-D the A beta is predominantly found in blood vessels and in early parenchymal plaques, whereas in AD parenchymal A beta deposits in the form of senile plaques and neurofibrillary tangles are a more prominent finding. Point mutations in the amyloid precursor protein (APP) have recently been described, in both conditions. A G to C transversion at codon 618 (extracellular portion of APP695), producing a single amino acid substitution of glutamine instead of glutamine acid, occurs in HCHWA-D; whereas mutations at codon 642 in the intramembrane region of APP695 (phenylalanine, isoleucine, or glycine instead of valine) are associated with early onset FAD. This suggests that the site of particular mutations in the APP gene and the type of amino acid substitution in the APP holoprotein are more important in determining clinicopathological phenotype and age at which A beta is deposited. Thus FAD and HCHWA-D can be regarded as two sides of the same coin.
Mol Neurobiol 1992
PMID:Molecular biology of Alzheimer's amyloid--Dutch variant. 146 89

Exon 1 polymorphism of the androgen receptor (AR) gene is characterized by a (CAG)n(CAA) repeat at position 172 following the translation start codon. The aim of this study was to determine whether AR gene exon 1 polymorphism could be used to perform prenatal diagnosis in high risk families with complete or partial androgen insensitivity syndrome. After enzymatic amplification of a 1 kilobase exon 1 fragment, each DNA was simultaneously digested by MspI and PstI restriction enzymes. After electrophoresis on a 15% electrophoresis on a 15% acrylamide gel or a 6% Nusieve gel, we measured the size of the obtained fragments and determined the number of CAG repeats since a 282 basepair fragment corresponds to 21 CAG. We previously showed that the number of CAG repeats within the AR gene exon 1 in 23 families with complete or partial androgen insensitivity syndrome was 19 +/- 4. By this method, we detected heterozygosity in 50% of the mothers. We present here 2 exclusion prenatal diagnoses using exon 1 polymorphism of the AR gene. Family A presented a boy with a severe form of partial androgen insensitivity syndrome. The mother had 2 uncles with ambiguous genitalia. In family B, the affected child had a complete androgen insensitivity syndrome. In both families, analysis of the AR gene exon 1 polymorphism of the trophoblastic DNA showed the presence of the normal maternal X chromosome. The parents decided to carry on the gestation. In family A, the newborn had normal male external genitalia. In family B, sonography confirmed the presence of normal male external genitalia. These data suggest that exon 1 polymorphism of the AR gene could be prenatally used to predict androgen insensitivity syndrome.
J Steroid Biochem Mol Biol 1992 Dec
PMID:Prenatal prediction of androgen insensitivity syndrome using exon 1 polymorphism of the androgen receptor gene. 147 58

A rat medullary thyroid carcinoma cell line, CA77, was used to study the effect of a series of biosynthesized protease inhibitors on the proteolytic cleavage of the endogenously synthesized pro-CGRP. This cell line efficiently converted the pro-CGRP to mature CGRP as assessed by chromatography of cell extracts followed by radioimmunoassay for CGRP. CA77 cells were transfected with expression vectors encoding protease inhibitors: the Arg-serpins, alpha 1-antitrypsin Pittsburgh (358 Met----Arg) and plasminogen activator inhibitor 1, the Kazal type serine protease inhibitor, pancreatic secretory trypsin inhibitor, and the general thiol protease inhibitor, cystatin C. Only the chromatography of cell extracts from CA77 cells transfected with a plasmid encoding cystatin C showed an apparent higher content of unprocessed pro-CGRP as compared to non-transfected cells. No effect on pro-CGRP processing could be measured in the CA77 cells transfected with plasmids encoding the three serine protease inhibitors. CA77 cells were also transfected with two constructs encoding chimeric proteins consisting of cystatin C and the precursor for neuropeptide Y. Release experiments using 8-bromo cAMP as the secretagogue showed that the chimer was co-released with CGRP. However, no effect of this chimer upon pro-CGRP processing could be detected. It is concluded that the processing of pro-CGRP in the CA77 cell line was very efficient and that four different protease inhibitors and two cystatin C/NPY chimers synthesized by this neuroendocrine cell line had only minimal effect upon the processing of CGRP.
Mol Cell Endocrinol 1991 Nov
PMID:Processing of pro-CGRP in a rat medullary thyroid carcinoma cell line transfected with protease inhibitors. 176 Nov 66

Recent work has demonstrated that a tripeptide derivative mimicking the active proteinase-binding site of cystatin C, a human cysteine proteinase inhibitor, can block growth of group A streptococci and replication of herpes simplex virus (HSV). In the case of HSV, intact cystatin C was also found to inhibit replication of the virus. Many streptococcal strains and HSV-infected cells produce immunoglobulin (Ig)-binding proteins, and a possible connection between such proteins and proteolytic activity was indicated by the finding that bacterial Ig-binding proteins also show affinity for proteinase inhibitors. The significance of these various observations is not clear, but available data suggest that proteinases play a role in vital microbial functions (e.g. viral replication) and may be utilized as targets for antimicrobial agents. The results discussed here also indicate that peptide derivatives based on the structure of proteinase inhibitors occurring in nature could be used as such agents.
Mol Microbiol 1990 Sep
PMID:Proteinase inhibition, immunoglobulin-binding proteins and a novel antimicrobial principle. 196 37

Expression of the RNA replicase domain of tobacco mosaic virus (TMV) and certain protein-coding regions in other plant viruses, is mediated by translational readthrough of a leaky UAG stop codon. It has been proposed that normal tobacco tyrosine tRNAs are able to read the UAG codon of TMV by non-conventional base-pairing but recent findings that stop codons can also be bypassed as a result of extended translocational shifts (tRNA hopping) have encouraged a re-examination. In light of the alternatives, we investigated the sequences flanking the leaky UAG codon using an in vivo assay in which bypass of the stop codon is coupled to the transient expression of beta-glucuronidase (GUS) reporter genes in tobacco protoplasts. Analysis of GUS constructions in which codons flanking the stop were altered allowed definition of the minimal sequence required for read through as UAG-CAA-UUA. The effects of all possible single-base mutations in the codons flanking the stop indicated that 3' contexts of the form CAR-YYA confer leakiness and that the 3' context permits read through of UAA and UGA stop codons as well as UAG. Our studies demonstrate a major role for the 3' context in the read through process and do not support a model in which teh UAG is bypassed exclusively as a result of anticodon-codon interactions. No evidence for tRNA hopping was obtained. The 3' context apparently represents a unique sequence element that affects translation termination.
J Mol Biol 1991 Mar 20
PMID:The signal for a leaky UAG stop codon in several plant viruses includes the two downstream codons. 201 Sep 14

We have examined the amino acid sequences of a number of proteins that have been suggested to be related to chicken cystatin, a protein from chicken egg white that inhibits cysteine proteinases. On the basis of statistical analysis, the following proteins were found to be members of the cystatin superfamily: human cystatin A, rat cystatin A(alpha), human cystatin B, rat cystatin B(beta), rice cystatin, human cystatin C, ox colostrum cystatin, human cystatin S, human cystatin SA, human cystatin SN, chicken cystatin, puff adder cystatin, human kininogen, ox kininogen, rat kininogen, rat T-kininogens 1 and 2, human alpha 2HS-glycoprotein, and human histidine-rich glycoprotein. Fibronectin is shown not to be a member of this superfamily, and the c-Ha-ras oncogene protein p21 (Val-12) probably is not a member also. It was convenient to divide members of the superfamily into four types on the basis of the presence of one, two, or three copies of cystatin-like segments and the presence or absence of disulfide bonds. Evolutionary dendrograms were calculated by three methods, and from these we have constructed a scheme depicting the sequence of events in the evolution of these proteins. We suggest that about 1000 million years ago a precursor containing disulfide loops appeared, and that all disulfide-containing cystatins are derived from this. We follow the evolution of the proteins of the superfamily along four main lineages, with special attention to the part that duplication of segments has played in the development of the more complex molecules.
J Mol Evol 1990 Jan
PMID:Evolution of proteins of the cystatin superfamily. 210 24


1 2 3 4 5 6 7 8 9 10 Next >>