Gene/Protein Disease Symptom Drug Enzyme Compound
Pivot Concepts:   Target Concepts:
Query: UNIPROT:P01034 (cystatin C)
 3,397 document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)

The nucleotide sequence of T4 species I RNA, one of several stable RNA's specifically coded for by bacteriophage T4, has been determined using 32-P-labeled material from T4-infected cultures of Escherichia coli. The purified RNA species which has been sequenced has been shown to hybridize well to T4 DNA (Wilson J.H., Kim, J.S., and Abelson, J.N. (1972) J. Mol. Biol. 71, 547-556). The sequence is: pCGAUUCGAGGAAAUAUCUUUGCCGUAAGCCGAGUAGCGUUUUUGACGGAACGUUCGGAUAUGGUUGAGAUAUGGCCUUUUAAAAUAUUGAGUAGCGUCAACUACUUAAUAACCGGGUUCGAAUCCCGGCGUUUCGU-CAA-OHACA-OH. Species I RNA which is 140 nucleotides long is also found to occur in shorter versions with 135 to 136 nucleotides which terminate with a 3'-phosphate. The molecule can be arranged in a secondary structure which shows some striking similarities to the classic cloverleaf pattern of a tRNA. The molecule is specifically cleaved by an E. coli nuclease into three segments by cleavage at a double-stranded region in the molecule. The function of species I RNA is unknown, but evidence presented elsewhere (Paddock, G.V., and Abelson, J. (1975) J. Biol. Chem. 250, 4207-4219) indicates that the gene for this RNA molecule has been preserved in evolution. The position of a mutation within species I RNA has been determined. This mutation results in incorrect processing of the RNA and lower relative yields of the RNA are present.
 ...
PMID:Nucleotide sequence determination of bacteriophage T4 species I ribonucleic acid. 109 86

A proximal promoter (-422/-13) of the bean seed storage protein beta-phaseolin gene contains cis-regulatory elements conferring spatial and temporal gene regulation. To correlate trans-acting elements with these cis-elements, we performed gel mobility shift and exonuclease III protection assays using bean seed nuclear proteins, and identified target sequences of four DNA-binding proteins associated with this promoter. Three CANNTG motifs, CACGTG (-248/-243), CACCTG (-163/-158), and CATATG (-100/-95), were determined as target sequences of the same DNA-binding protein designated CAN. Competition assays using oligonucleotides containing the wild-type or mutated CANNTG motif indicated that the CANNTG motif appears to be a preferred target sequence for CAN binding. Competition assays also demonstrated that DNA-binding protein AG-1 binds to AAAAAG(A/G)CAA (-356/-347, -191/-182), CA-1 binds to two CA-rich sequences (-201/-192, -175/-160), and that a TATA-box binding protein binds to either TATATAA (-43/-37) or TATAAA (-32/-27) or both. Based on these and other results, it is proposed that CACGTG motif (-248/-243) is a major cis-acting regulatory element conferring spatial and temporal control of the beta-phaseolin gene.
 ...
PMID:Four distinct nuclear proteins recognize in vitro the proximal promoter of the bean seed storage protein beta-phaseolin gene conferring spatial and temporal control. 130 41

The glycogen phosphorylase-2 (GP2) activity that appears during the cell differentiation of Dictyostelium was purified to homogeneity. The molecular weight of the nondenatured enzyme was 200,000 as determined by Sephacryl S-300 gel filtration and was 107,000 on sodium dodecyl sulfate-polyacrylamide gel electrophoresis, suggesting that the native enzyme consists of two similar subunits. The intact protein was digested with trypsin and protease V8, and the resulting peptides were purified by microbore high pressure liquid chromatography. The peptides were sequenced, and oligonucleotides were constructed for polymerase chain reaction amplification of the GP2 gene from Dictyostelium genomic DNA template. The resulting polymerase chain reaction products were sequenced directly and were confirmed to encode portions of the GP2 gene. These fragments were used to probe a partial EcoRI genomic library for the remainder of the GP2 gene. The nucleotide sequence of the GP2-selected clones revealed an open reading frame of 2975 base pairs that was interrupted by two introns of 109 and 105 base pairs, respectively. The open reading frame encoded a protein of 992 amino acids with a calculated molecular mass of 112,500 Da and an isoelectric point of 6.4. An unusual sequence within the second exon of GP2, in which the triplet CAA was repeated 11 times, resulted in 11 in-frame glutamine residues of a possible 15 amino acids coded for by this region. The CAA repeat was transcribed, as shown by the sequence of cDNA. Comparison of the amino acid sequence of Dictyostelium GP2 to the phosphorylases from other organisms revealed that the Dictyostelium protein was 50 and 44% identical to yeast and rabbit muscle phosphorylases, respectively. Northern blot analysis showed that GP2 mRNA was absent in amebas and the early stages of development, reached a maximum level of expression at the slug stage, and then decreased in the terminal stages of development. Comparison of the mRNA expression with the appearance of GP2 enzyme protein and enzyme activity revealed that gp2 mRNA and a 113-kDa GP2 enzyme peptide were expressed concurrently at 10 h of development. However, enzyme activity did not appear until 18 h, coincident with a decrease in the level of the 113-kDa peptide and a corresponding increase in the amount of a 106-kDa GP2 peptide. Addition of cAMP to aggregation-competent cells in liquid culture resulted in the induction of GP2 mRNA, GP2 protein, and GP2 enzyme activity.
 ...
PMID:Cloning, structural analysis, and expression of the glycogen phosphorylase-2 gene in Dictyostelium. 131 Mar 12

An alkaline unwinding assay was used to quantitate the induction of DNA strand breaks (DNA SB) in the livers of rats and mice treated in vivo, in rodent hepatocytes in primary culture, and in CCRF-CEM cells, a human lymphoblastic leukemia cell line, following treatment with tri- (TCA), di- (DCA), and mono- (MCA) chloroacetic acid and their corresponding aldehydes, tri- (chloral hydrate, CH), di- (DCAA) and mono- (CAA) chloroacetaldehyde. None of the chloroacetic acids induced DNA SB in the livers of rats at 4 hr following a single administration of 1-10 mmole/kg. TCA (10 mmole/kg) and DCA (5 and 10 mmole/kg) did produce a small amount of strand breakage in mice (7% at 4 hr) but not at 1 hr. N-nitrosodiethylamine (DENA), an established alkylating agent and a rodent hepatocarcinogen, produced DNA SB in the livers of both species. TCA, DCA, and MCA also failed to induce DNA strand breaks in splenocytes and epithelial cells derived from the stomach and duodenum of mice treated in vivo. None of the three chloroacetaldehydes induced DNA SB in either mouse or rat liver. The continuous exposure of mice to 5 g/L DCA in the drinking water for 7 and 14 days did not induce appreciable hepatic DNA SB (< 10% at 14 days), although peroxisome proliferation, as evidenced by an increased cyanide-insensitive palmitoyl CoA oxidase (PCO) activity, was stimulated to 490% (7 days) and 652% (14 days) of control. Under this protocol, DENA (0.1 g/L) produced DNA damage after both 7 days (73% of control) and 14 days (57% of control). Similarly, long-term exposure of rats (30 weeks) to 2 g/L DCA in the drinking water, a level that increased PCO activity to 364% of the control value, exhibited no DNA damage. Both the chloroacetic acids and the chloroacetaldehydes were ineffective in inducing DNA SB in cultured rat and mouse hepatocytes at concentrations below those that yielded cytotoxicity. The chloroacetic acids were also ineffective in the CCRF-CEM cells. However, two of the chloroaldehydes, DCAA and CAA, did induce DNA SB in the CCRF-CEM cells at concentrations that did not decrease the cell viability after 2 hr of treatment. Prior incubation of DCAA and CAA with a rat S9 liver homogenate eliminated much of the DNA damaging activity. These studies provide further evidence that the chloroacetic acids lack genotoxic activity not only in rodent liver, a tissue in that they induce tumors, but in a variety of other roden tissues and cultured cell types.(ABSTRACT TRUNCATED AT 400 WORDS)
 ...
PMID:Analysis of DNA strand breaks induced in rodent liver in vivo, hepatocytes in primary culture, and a human cell line by chlorinated acetic acids and chlorinated acetaldehydes. 133 May 47

Two members (CST4 and CST5) of the cystatin gene family have been characterized partially by DNA analysis. The CST4 clone contained the gene coding for the precursor form(141 amino acids) of cystatin S, and its exon-intron organization is the same as that of other members (the cystatin SN gene at the CST1 locus, the cystatin SA gene at the CST2 locus, the cystatin C gene at the CST3 locus and a cystatin pseudogene at the CSTP1 locus). The second cystatin pseudogene was elucidated in the clone, CST5, and it was assigned to the CSTP2 locus. Alignment of DNA sequences of cystatin genes with other genes suggested that the genes for cystatins, kininogens, and Bowman-Birk type inhibitors have evolved from an ancient ribonuclease-like gene.
 ...
PMID:Characterization of two members (CST4 and CST5) of the cystatin gene family and molecular evolution of cystatin genes. 133 20

About 1800 sequences of gene promoters, enhancers and other types of regulatory elements (REG) have been statistically analysed for investigation of a role for enzymatic DNA methylation in prokaryotes, yeasts, plants, invertebrates, animal viruses, vertebrates and human. The frequencies and localizations of CG and CNG methylated sites and also the number of CG-->TG+CA transitions in different series of REGs have been studied. It was showed that the pro- and eukaryotic REGs with the exception of yeast and drosophila ones have higher CpG-suppression values than the main genome in the same species. About 40% of all the point substitutions in pro- and eukaryotic REGs were found in the CG and CNG methylated sites, that are "hot spots" for C-->T transitions. More than 30% of all analysed REGs have neither sites CG nor CNG and so they are not capable of methylation in vivo. The methylated sites have not been localized in any specific regions of promoters and other types of REGs nor in the flanking sequences of the same genes. Only part of the homological REG's sequences have CG and CNG methylated sites. Therefore the methylation of cytosine residues in any REGs may be not an obligatory condition for normal regulation of the REG activity in cells. Two main REG's families of different length were unexpectedly found in the study. The length of the first one is 9-12 n. and the second is 17-20 n. The families are about 60-80% of other REGs. The essential deficiency of cytosine residues and also triplets of CGG, CCG, CTG and CAG has been showed in the "sense" chain of the REGs. The chain has some abundance of TTG, CCA and CAA triplets. The REG's chains have a strong asymmetry in purine and pyrimidine contents and also in duplets TG and CA frequencies. It may be the result of different reparation effectivity of G-T pairs produced by 5-meC residues deamination in DNA complementary chains. Therefore cytosine methylation in REGs may strongly destabilize the structure, accelerate its divergence in evolution, and disturb the REGs binding with protein factors regulating activity of the genes. The results showed that a function of DNA enzymatic methylation may be hardly realized through the modification of gene regulatory elements.
 ...
PMID:[Enzymatic methylation of regulatory elements in controlling the activity of genes from various groups of organisms]. 133 47

A new DNA variant in the promoter region of the human cystatin C gene has been detected by direct sequencing. The base substitution generates a new DdeI restriction site, thus allowing the design of a rapid polymerase chain reaction assay for analysis of this polymorphism in the population.
 ...
PMID:PCR assay for a polymorphic DdeI site in the promoter region of the human cystatin C gene. 134 51

In order to better understand the molecular events in murine hepatocarcinogenesis, the frequency and types of mutations in the murine H-ras proto-oncogene isolated from 184 independent, spontaneously occurring hepatic lesions were determined. Hepatocellular foci, hyperplasias, adenomas and carcinomas were obtained from archival samples of control male (134 samples) and female (50 samples) B6C3F1 mice used in oncogenicity studies that were conducted at Lilly Research Laboratories from 1979 to 1986. The 61st codon region of the H-ras oncogene from these sections was amplified using the polymerase chain reaction. Mutation frequencies were determined by restriction fragment length polymorphism analysis. The types of mutations were characterized by allele-specific oligonucleotide hybridization and confirmed by DNA sequencing. Forty-two per cent of the carcinomas, 44% of the adenomas, 42% of the hyperplasias and 29% of the foci contained mutations at the 61 codon. The mutation spectra for the carcinomas, adenomas and hyperplasias consisted of mostly CAA-AAA transversions, followed by CAA-CGA transitions, followed by CAA-CTA transversions. These results demonstrate that: (i) the frequency of spontaneous mutations in the H-ras 61st codon is equivalent in murine hyperplasias, adenomas and carcinomas, and (ii) sex was not a determining factor in either the mutation frequency or mutation spectrum for the spontaneous lesions. If these lesions represent successive stages in the carcinogenic process, then these results suggest that mutations in the 61st codon of H-ras are early events in spontaneous murine hepatocarcinogenesis.
 ...
PMID:Genetic alterations in the 61st codon of the H-ras oncogene isolated from archival sections of hepatic hyperplasias, adenomas and carcinomas in control groups of B6C3F1 mouse bioassay studies conducted from 1979 to 1986. 135 Sep 49

Hereditary cystatin C amyloid angiopathy (HCCAA) is a dominantly inherited disease characterized by amyloidosis, dementia and fatal cerebral hemorrhage of young adults. A method for rapid and simple diagnosis of HCCAA is described. It is based upon oligonucleotide-directed enzymatic amplification of a 275-bp genomic DNA segment containing exon 2 of the cystatin C gene from a blood sample, followed by digestion of the amplification product with AluI. Loss of an AluI recognition site in the amplified DNA segment from HCCAA patients results in a deviating band-pattern at agarose gel electrophoresis, compared with that obtained from normal subjects or unaffected HCCAA family members. In a population of 9 patients with manifest HCCAA, 14 patients with other causes of brain hemorrhage and 16 healthy individuals, the diagnostic procedure displayed a sensitivity and specificity for HCCAA of 100%. Amplified DNA segments from 4 HCCAA patients of four different families were analyzed by nucleotide sequencing; the HCCAA-causing mutation in all families was found to be a single T----A substitution in the codon for amino acid residue 68 of cystatin C.
 ...
PMID:Hereditary cystatin C amyloid angiopathy: identification of the disease-causing mutation and specific diagnosis by polymerase chain reaction based analysis. 135 69

We have examined the effects of prolonged histidine deprivation on the reversion of Salmonella typhimurium histidine auxotrophs containing either hisG46, a missense mutation (CTC----CCC), or hisG428, an ochre mutation (CAA----TAA). Both of these mutants can revert to His+ via intragenic and extragenic mechanisms. Whereas the hisG46 mutant site consists of G/C base pairs, extragenic suppression of hisG46 requires mutation at an A/T site. Conversely, the hisG428 site itself contains only A/T base pairs, and extragenic suppression of hisG428 occurs principally at G/C sites. Thus, by examining the mutational spectrum of hisG46 and hisG428 revertants that occurred in the presence and in the absence of histidine, it was possible to determine the effects of histidine starvation on mutations at G/C vs. A/T sites as well as on intragenic sites vs. extragenic suppressor sites. Using DNA-colony hybridization, we determined the DNA sequences of over 1300 hisG46 and hisG428 revertants. Histidine-independent revertants that arose during growth in liquid medium that contained histidine included both intragenic and extragenic suppressor mutations. The relative frequency of such extragenic suppressors was greatly reduced among the His+ revertants that were isolated after 5-10 days of histidine starvation on agar medium. Moreover, DNA sequence analysis revealed striking differences in the distribution of particular transversions at the hisG428 locus in revertants arising after prolonged histidine starvation as compared to those arising after growth in the presence of histidine.
 ...
PMID:Sequence analysis of mutations arising during prolonged starvation of Salmonella typhimurium. 142 30


1 2 3 4 5 6 7 8 9 10 Next >>