Gene/Protein Disease Symptom Drug Enzyme Compound
Pivot Concepts:   Target Concepts:
Query: UNIPROT:P01034 (cystatin C)
 3,397 document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)

The nucleotide sequences of the two glutamine tRNA species in Escherichia coli K12 have been determined. Sufficient data was obtained to order unambiguously the products of complete RNase digestion of tRNA2Gln, and all but one oligonucleotide from tRNA1Gln. The sequence of tRNA1Gln was established by analogy with tRNA1Gln, as the two tRNAs are very similar, differing by only 7 residues out of 75. tRNA1Gln has the anticodon NUG, where N is a modified nucleotide which is likely to be a derivative of 2-thiouridine, and is specific for the codon CAA. tRNA1Gln has the anticodon CUG, and is specific for the codon CAG (Folk, W. R., and Yaniv, M. (1972) Nature 237, 165). The complete sequences of the tRNAGln species are: See journal for formula (Unique residues are enclosed in parentheses, with the residue in tRNA1Gln above that in tRNA2Gln.).
 ...
PMID:The nucleotide sequences of the two glutamine transfer ribonucleic acids from Escherichia coli. 16 64

Seven infants (two French Canadian, four Ashkenazi Jewish, and one Greek) with massive selective hyperiminoglycinuria (proline, hydroxyproline, and glycine) were detected by urine screening in the second week of life. Follow-up investigations and family studies revealed that each subject had a benign condition, familial renal iminoglycinuria, an autosomal recessive condition. The family studies (Table 1 and Fig. 1) indicate the presence of at least two different mutant alleles segregating in this small group of probands. Hmozygotes of two forms and one genetic compound were identified. Quantitative studies revealed normal concentrations of proline and glycine in plasma (Fig. 2), normal maturation of creatinine clearance (as an index of glomerular filtration rate) (Fig. 3), and elevated renal clearance of proline and glycine (Table 2). Fractional excretion (CAA/CCR) of both proline and glycine in the probands was far in excess of that expected for the normal postnatal infant; FFPro and FEGly approached 100% of the filtered load on occasion (Fig. 4). A schedule of maturing tubular reabsorptive activity was apparent in the proband group. Proline reabsorption matured earlier than glycine reabsorption in the homozygotes (and the genetic compound) as it does in the normal infants (Fig. 5). Our findings suggest that three gene products serve net tubular reabsorption of imino acids and glycine in human kidney. One, affected by mutation in our patients, is responsible for a shared transport activity; a second with preference for proline, and not affected by the mutation, has an "early" schedule of postnatal maturation; and a third with preference for glycine, also not affected by the mutation, has a "late" schedule of maturation.
 ...
PMID:Ontogeny of amino acid reabsorption in human kidney. Evidence from the homozygous infant with familial renal iminoglycinuria for multiple proline and glycine systems. 43 3

The nucleotide sequence of T4 species I RNA, one of several stable RNA's specifically coded for by bacteriophage T4, has been determined using 32-P-labeled material from T4-infected cultures of Escherichia coli. The purified RNA species which has been sequenced has been shown to hybridize well to T4 DNA (Wilson J.H., Kim, J.S., and Abelson, J.N. (1972) J. Mol. Biol. 71, 547-556). The sequence is: pCGAUUCGAGGAAAUAUCUUUGCCGUAAGCCGAGUAGCGUUUUUGACGGAACGUUCGGAUAUGGUUGAGAUAUGGCCUUUUAAAAUAUUGAGUAGCGUCAACUACUUAAUAACCGGGUUCGAAUCCCGGCGUUUCGU-CAA-OHACA-OH. Species I RNA which is 140 nucleotides long is also found to occur in shorter versions with 135 to 136 nucleotides which terminate with a 3'-phosphate. The molecule can be arranged in a secondary structure which shows some striking similarities to the classic cloverleaf pattern of a tRNA. The molecule is specifically cleaved by an E. coli nuclease into three segments by cleavage at a double-stranded region in the molecule. The function of species I RNA is unknown, but evidence presented elsewhere (Paddock, G.V., and Abelson, J. (1975) J. Biol. Chem. 250, 4207-4219) indicates that the gene for this RNA molecule has been preserved in evolution. The position of a mutation within species I RNA has been determined. This mutation results in incorrect processing of the RNA and lower relative yields of the RNA are present.
 ...
PMID:Nucleotide sequence determination of bacteriophage T4 species I ribonucleic acid. 109 86

A proximal promoter (-422/-13) of the bean seed storage protein beta-phaseolin gene contains cis-regulatory elements conferring spatial and temporal gene regulation. To correlate trans-acting elements with these cis-elements, we performed gel mobility shift and exonuclease III protection assays using bean seed nuclear proteins, and identified target sequences of four DNA-binding proteins associated with this promoter. Three CANNTG motifs, CACGTG (-248/-243), CACCTG (-163/-158), and CATATG (-100/-95), were determined as target sequences of the same DNA-binding protein designated CAN. Competition assays using oligonucleotides containing the wild-type or mutated CANNTG motif indicated that the CANNTG motif appears to be a preferred target sequence for CAN binding. Competition assays also demonstrated that DNA-binding protein AG-1 binds to AAAAAG(A/G)CAA (-356/-347, -191/-182), CA-1 binds to two CA-rich sequences (-201/-192, -175/-160), and that a TATA-box binding protein binds to either TATATAA (-43/-37) or TATAAA (-32/-27) or both. Based on these and other results, it is proposed that CACGTG motif (-248/-243) is a major cis-acting regulatory element conferring spatial and temporal control of the beta-phaseolin gene.
 ...
PMID:Four distinct nuclear proteins recognize in vitro the proximal promoter of the bean seed storage protein beta-phaseolin gene conferring spatial and temporal control. 130 41

The glycogen phosphorylase-2 (GP2) activity that appears during the cell differentiation of Dictyostelium was purified to homogeneity. The molecular weight of the nondenatured enzyme was 200,000 as determined by Sephacryl S-300 gel filtration and was 107,000 on sodium dodecyl sulfate-polyacrylamide gel electrophoresis, suggesting that the native enzyme consists of two similar subunits. The intact protein was digested with trypsin and protease V8, and the resulting peptides were purified by microbore high pressure liquid chromatography. The peptides were sequenced, and oligonucleotides were constructed for polymerase chain reaction amplification of the GP2 gene from Dictyostelium genomic DNA template. The resulting polymerase chain reaction products were sequenced directly and were confirmed to encode portions of the GP2 gene. These fragments were used to probe a partial EcoRI genomic library for the remainder of the GP2 gene. The nucleotide sequence of the GP2-selected clones revealed an open reading frame of 2975 base pairs that was interrupted by two introns of 109 and 105 base pairs, respectively. The open reading frame encoded a protein of 992 amino acids with a calculated molecular mass of 112,500 Da and an isoelectric point of 6.4. An unusual sequence within the second exon of GP2, in which the triplet CAA was repeated 11 times, resulted in 11 in-frame glutamine residues of a possible 15 amino acids coded for by this region. The CAA repeat was transcribed, as shown by the sequence of cDNA. Comparison of the amino acid sequence of Dictyostelium GP2 to the phosphorylases from other organisms revealed that the Dictyostelium protein was 50 and 44% identical to yeast and rabbit muscle phosphorylases, respectively. Northern blot analysis showed that GP2 mRNA was absent in amebas and the early stages of development, reached a maximum level of expression at the slug stage, and then decreased in the terminal stages of development. Comparison of the mRNA expression with the appearance of GP2 enzyme protein and enzyme activity revealed that gp2 mRNA and a 113-kDa GP2 enzyme peptide were expressed concurrently at 10 h of development. However, enzyme activity did not appear until 18 h, coincident with a decrease in the level of the 113-kDa peptide and a corresponding increase in the amount of a 106-kDa GP2 peptide. Addition of cAMP to aggregation-competent cells in liquid culture resulted in the induction of GP2 mRNA, GP2 protein, and GP2 enzyme activity.
 ...
PMID:Cloning, structural analysis, and expression of the glycogen phosphorylase-2 gene in Dictyostelium. 131 Mar 12

An alkaline unwinding assay was used to quantitate the induction of DNA strand breaks (DNA SB) in the livers of rats and mice treated in vivo, in rodent hepatocytes in primary culture, and in CCRF-CEM cells, a human lymphoblastic leukemia cell line, following treatment with tri- (TCA), di- (DCA), and mono- (MCA) chloroacetic acid and their corresponding aldehydes, tri- (chloral hydrate, CH), di- (DCAA) and mono- (CAA) chloroacetaldehyde. None of the chloroacetic acids induced DNA SB in the livers of rats at 4 hr following a single administration of 1-10 mmole/kg. TCA (10 mmole/kg) and DCA (5 and 10 mmole/kg) did produce a small amount of strand breakage in mice (7% at 4 hr) but not at 1 hr. N-nitrosodiethylamine (DENA), an established alkylating agent and a rodent hepatocarcinogen, produced DNA SB in the livers of both species. TCA, DCA, and MCA also failed to induce DNA strand breaks in splenocytes and epithelial cells derived from the stomach and duodenum of mice treated in vivo. None of the three chloroacetaldehydes induced DNA SB in either mouse or rat liver. The continuous exposure of mice to 5 g/L DCA in the drinking water for 7 and 14 days did not induce appreciable hepatic DNA SB (< 10% at 14 days), although peroxisome proliferation, as evidenced by an increased cyanide-insensitive palmitoyl CoA oxidase (PCO) activity, was stimulated to 490% (7 days) and 652% (14 days) of control. Under this protocol, DENA (0.1 g/L) produced DNA damage after both 7 days (73% of control) and 14 days (57% of control). Similarly, long-term exposure of rats (30 weeks) to 2 g/L DCA in the drinking water, a level that increased PCO activity to 364% of the control value, exhibited no DNA damage. Both the chloroacetic acids and the chloroacetaldehydes were ineffective in inducing DNA SB in cultured rat and mouse hepatocytes at concentrations below those that yielded cytotoxicity. The chloroacetic acids were also ineffective in the CCRF-CEM cells. However, two of the chloroaldehydes, DCAA and CAA, did induce DNA SB in the CCRF-CEM cells at concentrations that did not decrease the cell viability after 2 hr of treatment. Prior incubation of DCAA and CAA with a rat S9 liver homogenate eliminated much of the DNA damaging activity. These studies provide further evidence that the chloroacetic acids lack genotoxic activity not only in rodent liver, a tissue in that they induce tumors, but in a variety of other roden tissues and cultured cell types.(ABSTRACT TRUNCATED AT 400 WORDS)
 ...
PMID:Analysis of DNA strand breaks induced in rodent liver in vivo, hepatocytes in primary culture, and a human cell line by chlorinated acetic acids and chlorinated acetaldehydes. 133 May 47

About 1800 sequences of gene promoters, enhancers and other types of regulatory elements (REG) have been statistically analysed for investigation of a role for enzymatic DNA methylation in prokaryotes, yeasts, plants, invertebrates, animal viruses, vertebrates and human. The frequencies and localizations of CG and CNG methylated sites and also the number of CG-->TG+CA transitions in different series of REGs have been studied. It was showed that the pro- and eukaryotic REGs with the exception of yeast and drosophila ones have higher CpG-suppression values than the main genome in the same species. About 40% of all the point substitutions in pro- and eukaryotic REGs were found in the CG and CNG methylated sites, that are "hot spots" for C-->T transitions. More than 30% of all analysed REGs have neither sites CG nor CNG and so they are not capable of methylation in vivo. The methylated sites have not been localized in any specific regions of promoters and other types of REGs nor in the flanking sequences of the same genes. Only part of the homological REG's sequences have CG and CNG methylated sites. Therefore the methylation of cytosine residues in any REGs may be not an obligatory condition for normal regulation of the REG activity in cells. Two main REG's families of different length were unexpectedly found in the study. The length of the first one is 9-12 n. and the second is 17-20 n. The families are about 60-80% of other REGs. The essential deficiency of cytosine residues and also triplets of CGG, CCG, CTG and CAG has been showed in the "sense" chain of the REGs. The chain has some abundance of TTG, CCA and CAA triplets. The REG's chains have a strong asymmetry in purine and pyrimidine contents and also in duplets TG and CA frequencies. It may be the result of different reparation effectivity of G-T pairs produced by 5-meC residues deamination in DNA complementary chains. Therefore cytosine methylation in REGs may strongly destabilize the structure, accelerate its divergence in evolution, and disturb the REGs binding with protein factors regulating activity of the genes. The results showed that a function of DNA enzymatic methylation may be hardly realized through the modification of gene regulatory elements.
 ...
PMID:[Enzymatic methylation of regulatory elements in controlling the activity of genes from various groups of organisms]. 133 47

In order to better understand the molecular events in murine hepatocarcinogenesis, the frequency and types of mutations in the murine H-ras proto-oncogene isolated from 184 independent, spontaneously occurring hepatic lesions were determined. Hepatocellular foci, hyperplasias, adenomas and carcinomas were obtained from archival samples of control male (134 samples) and female (50 samples) B6C3F1 mice used in oncogenicity studies that were conducted at Lilly Research Laboratories from 1979 to 1986. The 61st codon region of the H-ras oncogene from these sections was amplified using the polymerase chain reaction. Mutation frequencies were determined by restriction fragment length polymorphism analysis. The types of mutations were characterized by allele-specific oligonucleotide hybridization and confirmed by DNA sequencing. Forty-two per cent of the carcinomas, 44% of the adenomas, 42% of the hyperplasias and 29% of the foci contained mutations at the 61 codon. The mutation spectra for the carcinomas, adenomas and hyperplasias consisted of mostly CAA-AAA transversions, followed by CAA-CGA transitions, followed by CAA-CTA transversions. These results demonstrate that: (i) the frequency of spontaneous mutations in the H-ras 61st codon is equivalent in murine hyperplasias, adenomas and carcinomas, and (ii) sex was not a determining factor in either the mutation frequency or mutation spectrum for the spontaneous lesions. If these lesions represent successive stages in the carcinogenic process, then these results suggest that mutations in the 61st codon of H-ras are early events in spontaneous murine hepatocarcinogenesis.
 ...
PMID:Genetic alterations in the 61st codon of the H-ras oncogene isolated from archival sections of hepatic hyperplasias, adenomas and carcinomas in control groups of B6C3F1 mouse bioassay studies conducted from 1979 to 1986. 135 Sep 49

Clinical findings were compared with the results of molecular analysis in 16 Japanese patients from 10 unrelated families with the adult/chronic form of GM1 gangliosidosis. Age of onset ranged from 3 to 30 years. Major clinical manifestations were gait and speech disturbances caused by persistent muscle hypertonia. Dystonic postures and movements, facial grimacing, and parkinsonian manifestations were commonly seen. Cerebellar signs, myoclonus, severe intellectual impairment, dysmorphism, or visceromegaly were not observed. A common single-base substitution, 51Ile(ATC)----Thr(ACC), reported in a previous study of ours, was confirmed in 14 patients by the Bsu36I restriction site analysis; one was a compound heterozygote with another mutation (457Arg[CGA]----Gln[CAA]) and the others were homozygotes of this mutation. Clinically, the compound-heterozygous patient showed more severe neurological manifestations and a more rapid clinical course than those of homozygotes. The homozygotes showed considerable variations in the age of onset and subsequent clinical course. The 51Ile----Thr mutant allele expressed a significant amount of beta-galactosidase activity, whereas the 457Arg----Gln mutant allele expressed extremely low activity in human GM1 gangliosidosis fibroblasts. We conclude that these gene mutations causing different residual enzyme activities are related to the severity of clinical manifestations, but some other genetic or environmental factors contribute to clinical heterogeneity. The Bsu36I restriction site analysis was performed in 7 families and provided clear results for the diagnosis of heterozygotes as well as homozygotes of this specific clinical form of GM1 gangliosidosis. The technique is applicable to prenatal diagnosis and genetic counseling.
 ...
PMID:GM1 gangliosidosis in adults: clinical and molecular analysis of 16 Japanese patients. 135 43

Based on the incidence survey of leukemia and aplastic anemia (AA) from 1986 to 1988, Case control studies (1257 new leukemia cases and 339 new AA cases) were carried out according to the type of leukemia and AA in order to better understand the epidemiologic characteristics of the diseases. Controls were matched randomly (age, sex and ethnic group) from the same population. The data were analyzed with the conditional Logistic multi-regression model and calculated on an IBM-PC/XT. The risk factors of M2a were found to be X-rays, antipyretics, benzene, pesticides and bimolane; that of M3 was chloramphenicol; that of M5 was X-rays; and that of other ANLLs was phenylbutazone. The risk factors of ALL were chloramphenicol, phenylbutazone and family members with cancer; those of CML were X-rays and hepatitis; those of CLL were chloramphenicol and benzene; those of AAA were antipyretics and hepatitis; and that of CAA ws X-rays.
 ...
PMID:[Risk factors analysis of leukemia and aplastic anemia in China. Chinese Epidemiologic Study Group of Leukemia and Aplastic Anemia]. 139 36


1 2 3 4 5 6 7 8 9 10 Next >>