Gene/Protein Disease Symptom Drug Enzyme Compound
Pivot Concepts:   Target Concepts:
Query: UMLS:C0679427 (myeloblastosis)
982 document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)

Purified reverse transcriptase from avian myeloblastosis virus or Rous sarcoma virus consists of two subunits of average mol wt of 100,000 and 60,000. The lower-molecular-weight subunit, alpha, has been isolated from avian myeloblastosis virus, Rous sarcoma virus and a temperature-sensitive mutant of Rous sarcoma virus, LA337. Subunit alpha manifests both the DNA polymerase and RNase H activities associated with purified reverse transcriptase of avian RNA tumor viruses. The thermal inactivation of these enzymatic activities of alpha subunit from the wild-type virus. The results show that both DNA polymerase and RNase H activities associated with the alpha subunit of LA337 are five to seven times more thermolabile then the corresponding alpha subunit from the wild-type virus. It is concluded that (i) both the polymerase and nuclease activities reside on the same polypeptide chain, and (ii) at least the lower-molecular-weight subunit alpha is coded for by the viral RNA.
...
PMID:Studies on reverse transcriptase of RNA tumor viruses. I. Localization of thermolabile DNA polymerase and RNase H activities on one polypeptide. 4 81

DNA polymerase from RNA tumor viruses ("reverse transcriptase") has been analyzed for activities which have been associated with other DNA polymerases. Homogeneous DNA polymerase from avian myeoblastosis virus catalyzes pyrophosphate exchange and pyrophosphorolysis. Pyrophosphate exchange is dependent on a template and is base-specific. With avian myeloblastosis virus DNA polymerase, ribonucleotide templates are more efficient for synthesis while deoxyribonucleotide templates are more effective for pyrophosphate exchange. Synthesis, pyrophosphate exchange, and pyrophosphorolysis were inhibited by the chelating agent 1,10-phenanthroline, suggesting that enzyme-bound zinc is required for each of these reactions. The pyrophosphate exchange reaction was also demonstrated with the DNA polymerase from a mutant of Rous sarcoma virus that possesses a temperature-sensitive DNA polymerase. The pyrophosphate exchange reaction with the mutant polymerase is temperature-sensitive which demonstrates that pyrophosphate exchange is indeed catalyzed by the viral DNA polymerase and that the same mutation effects both DNA polymerase and pyrophosphatase activity. Unlike Escherichia coli DNA polymerase I, the DNA polymerase from avian myeloblastosis virus fails to degrade polydeoxyribonucleotides or to convert deoxynucleoside triphosphates into monophosphates. This lack of hydrolytic activities in avian myeoblastosis DNA polymerase should facilitate kinetic studies on the mechanism of DNA synthesis by this enzyme.
...
PMID:On the fidelity of DNA replication. Enzyme activities associated with DNA polymerases from RNA tumor viruses. 5 14

Preparations of Rous sarcoma virus (RSV) can form an infectious viral-antibody complex with antibodies raised against the major glycoprotein, gp85, isolated from avian myeloblastosis virus and Prague-RSV subgroup C. Binding of anti-gp85 antibodies to RSV can be demonstrated by the inhibition of focus-forming activity after addition of goat anti-rabbit immunoglobulin and by a shift in density of virions treated with anti-gp85 serum. Group- rather than subgroup- specific regions of viral gp85 appear to be the site of binding for infectious complex.
...
PMID:Formation of an infectious virus-antibody complex with Rous sarcoma virus and antibodies directed against the major virus glycoprotein. 5 58

A sequence of 20 nucleotide residues immediately adjacent to the 3'-terminal poly(A) in Rous sarcoma virus (Prague strain, subgroup C) 35S RNA has been determined by extension of a riboguanylic acid-terminated oligothymidylic acid primer hybridized at the 5' end of the 3'-terminal poly(A) with purified reverse transcriptase (RNA-directed DNA polymerase; deoxynucleosidetriphosphate:DNA deoxynucleotidyltransferase, EC 2.7.7.7) from avian myeloblastosis virus. The sequence is 5'GCCAUUUUACCAUUCACCACpoly(A)3'. This same nucleotide sequence, excluding the poly(A) segment, has also been found at the 5' terminus of Rous sarcoma virus RNA (W. A. Haseltine, A. Maxam, and W. Gilbert, this issue pp. 989-993), and therefore the RNA genome of this virus is terminally redundant. Possible mechanisms for endogenous in vitro copying of the complete RNA genome by reverse transcriptase which involve terminally repeated nucleotide sequences are discussed.
...
PMID:Rous sarcoma virus genome is terminally redundant: the 3' sequence. 6 84

Based on the observation that in vitro transcription of Rous sarcoma virus (RSV) RNA by avian myeloblastosis virus DNA polymerase renders the RNA PROGRESSIVELY MORE SENSITIVE TO Escherichia coli RNase H digestion, a new procedure for the in situ analysis of this process has been developed. In vitro transcription products of 32P-labeled RSV RNA are first treated with RNase H, the resistant fraction is then digested to completion with RNase T1, and the oligonucleotides are analyzed by a fingerprint technique. By using the established order of these oligonucleotides along the RNA molecule, a comparison of the yields of each oligonucleotide, before and after transcription, allows qualitative and quantitative in situ analyses of the transcription process. Using this new procedure, we find that upon transcription of purified RSV RNA, DNA synthesis occurs mainly at three sites, one near the 5' end and two near the center of the subunit RNA molecule, and that most of these RNA molecules are competent templates for limited transcription at these specific sites. We also show that purified RSV 70S RNA contains a low-molecular-weight DNA hybridized to a nucleotide sequence near the center of the subunit molecule. Furthermore , we find that the low-molecular-weight nucleic acid fraction extracted from purified RSV virions contains DNA that can hybridize to RSV 70S RNA and that the virion DNA in such hybrids can function as a primer for an extensive in vitro reverse transcription.
...
PMID:New procedure for the direct analysis of in vitro reverse transcription of Rous sarcoma virus RNA. 6 18

Northern poke lymphosarcoma DNA polymerase was partially purified from particulate fractions banding at 1.15 to 1.16 g/ml from homogenates prepared from frozen necropsies of tumor-bearing pike. The enzyme behaves as a typical reverse transcriptase, in that it prefers ribotemplates to deoxytemplates. The isoelectric point (pl 5.5) is similar to that of avian myeloblastosis virus polymerase. The pike enzyme elutes from a phosphocellulose column at 0.22 M potassium phosphate, the same as avian myeloblastosis virus DNA polymerase. The enzyme activity is inhibited by pyran, a specific inhibitor of viral DNA polymerases. The most striking difference between the pike lymphoma polymerase and the other viral DNA polymerases tested is the low maximum temperature of 20 degrees, compared to 30 degrees for Rauscher leukemia virus polymerase and 38 degrees for avian myeloblastosis virus and Rous sarcoma virus.
...
PMID:Presence of DNA polymerase in lymphosarcoma in northern pike (Esox lucius). 6 92

Conditions are described that promote the efficient reverse transcription of most of Rous sarcoma virus (RSV) RNA sequences by avian myeloblastosis virus DNA polymerase in vitro. A detailed analysis of the reverse transcription reaction was carried out using two procedures: in situ analysis of the RNA sequences transcribed and DNA-RNA annealing studies. Under optimal conditions, after 1 h of reaction, practically all RSV RNA sequences were transcribed with a frequency varying from 30 to 90%. The DNA product was at least 95% single stranded, had a chain length ranging from a few hundred up to 5,000 necleotide residues, half of it being larger than 1,000 residues, and, after hybridization at RNA excess, protected the entire RSV genome from RNase digestion, as monitored by the large T1 oligonucleotides of RSV RNA. Analysis of the product of a very short reaction time (5 min) showed that DNA synthesis occurs mainly at three sites, one near the 5' end and two near the center of the subunit RNA. This in in agreement with our previous analysis of a much less efficient reverse transcription reaction. Under optimal conditions of reverse transcription, we find now that the RNase H associated with the avian myeloblastosis virus DNA polymerase is active in degrading the RNA moiety of the RNA-DNA hybrids synthesized.
...
PMID:Extensive in vitro transcription of rous sarcoma virus RNA by avian myeloblastosis virus DNA polymerase and concurrent activation of the associated RNase H. 7 May 39

A tridecamer oligodeoxynucleotide, d(A-A-T-G-G-T-A-A-A-A-T-G-G), which is complementary to reiterated 3'- and 5'-terminal nucleotides of Rous sarcoma virus 35S RNA, is an efficient inhibitor of the translation of proteins specified by the viral RNA in the wheat embryo cell-free system. The inhibition specificity for oncornavirus RNA is greater than for rabbit reticulocyte mRNA or brome mosaic virus RNA. Other oligodeoxynucleotides of similar size have little or no specific effect on the RNA-directed translation. The tridecamer acts as a primer for the avian myeloblastosis virus DNA polymerase when Rous sarcoma virus heated 70S RNA is used as a template, offering evidence that it can hybridize to the RNA. The possible use of such an oligodeoxynucleotide hybridization competitor to inhibit Rous sarcoma virus replication is described in the preceding paper [Zamecnik, P. C. & Stephenson, M. L. (1978) Proc. Natl. Acad. Sci. USA. 75, 280--284].
...
PMID:Inhibition of Rous sarcoma viral RNA translation by a specific oligodeoxyribonucleotide. 7 46

We have found that double-stranded cDNA synthesized in extended reactions by avian myeloblastosis virus reverse transcriptase is suitable substrate for a variety of restriction endonucleases. Experiments in which rabbit reticulocyte mRNA was reverse-transcribed and restricted to generate beta-globin-specifihe nucleotide sequence of beta-globin mRNA. This method has been applied to study collagen mRNA synthesis in normal and Rous sarcoma virus (RSV)-transformed chick embryo fibroblasts. Characteristic sets of collagen cDNA restriction fragments were produced from RNA fractions rich in collagen message activity. These sets of cDNA fragments, generated by the restriction endonucleases Hae III and Hap II, provided a convenient marker for the presence of collagen mRNA sequences. Equal quantities of high molecular weight mRNA from chick embryo fibroblasts (CEF) and RSV-CEF were reverse-transcribed and the resulting cDNA was restricted. The relative yields of collagen cDNA fragments from such reactions strongly suggest that the decrease in functional collagen RNA following RSV-induced transformation of CEF represents a decrease in the copy number of collagen messenger sequences. The potential of this approach for the study of regulation in other systems is discussed.
...
PMID:Decreased levels of collagen mRNA in rous sarcoma virus-transformed chick embryo fibroblasts. 7 27

A new DNA polymerase was partially purified from cell-free extracts of a continuous rat cell-line (XC). The XC cells had been transformed by the Prague strain of Rous sarcoma virus but did not produce infectious virus. The molecular weight of the DNA polymerase is 70,000, as estimated by glycerol gradient centrifugation and by Sephadex gel filtration. This enzyme can be distinguished from the other cellular DNA polymerases by its elution pattern on DNA-cellulose column chromatography, its molecular weight, and its primer-template specificity. The enzyme has some characteristics of the murine leukemia virus reverse transcriptase. It is partially inhibited by immunoglobulin G purified from rabbit antiserum prepared against Rauscher leukemia virus reverse transcriptase, but is not inhibited by IgG from rat antiserum prepared against avian myeloblastosis virus reverse transcriptase. However, the XC cell enzyme can be distinguished from the murine leukemia virus reverse transcriptase by its inefficiency in copying an oligo(dG)12-poly(rC)primer-template.
...
PMID:Partial purification and characterization of DNA polymerases from a Rous sarcoma virus-transformed rat cell line. 17 Sep 87


1 2 3 4 5 6 7 Next >>