Gene/Protein
Disease
Symptom
Drug
Enzyme
Compound
Pivot Concepts:
Gene/Protein
Disease
Symptom
Drug
Enzyme
Compound
Target Concepts:
Gene/Protein
Disease
Symptom
Drug
Enzyme
Compound
Query: UMLS:C0596263 (
carcinogenesis
)
64,820
document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)
Conversion of the 2'-deoxyguanosine (dG) residues in calf thymus DNA to 8-hydroxy-2'-deoxyguanosine (8-OH-dG) was achieved at physiological pH by treating the DNA with hydrogen peroxide (
H2O2
) in the presence of nickel(II) chloride (NiCl2). The effectiveness of this reaction was enhanced by L-histidine (His) which forms the Ni(II)-His2 complex. Similar effects of NiCl2 and His were observed on hydroxylation of pure dG with
H2O2
. The rate of pure dG conversion to 8-OH-dG at 37 degrees C (100 mM phosphate buffer) depended on combination and concentration of the reagents and on pH. Following 24 h incubation at pH 7.4 of 0.75 mM dG with 30 mM
H2O2
and 1 mM NiCl2, dG was converted into 8-OH-dG to the extent of 0.05% in the absence of His and 0.45% in the presence of 2 mM His. After 24 h incubation at pH 7.4 of 0.5 mg/ml DNA with 7.5 mM
H2O2
and 0.1 mM NiCl2, 0.18% of the dG moiety was converted into 8-OH-dG in the absence of His and 0.42% in the presence of 0.2 mM His. Interestingly, a mixture of
H2O2
with His was also capable of oxidizing dG to 8-OH-dG even in the absence of NiCl2, albeit less effectively than in the presence of NiCl2. This effect was not suppressed after treatment of dG, His and the buffer with Chelex to remove divalent metal contaminants, if any. The exact chemistry of the observed phenomena remains to be determined. Since the Ni(II)-His2 complex is the major low mol. wt nickel carrier in mammalian organisms, the observed redox properties of this complex, reported here for the first time, may be crucial for the toxicity and carcinogenicity of nickel.
Carcinogenesis
1992 Feb
PMID:Enhancement by nickel(II) and L-histidine of 2'-deoxyguanosine oxidation with hydrogen peroxide. 174 20
Previous studies have demonstrated that the interaction of (+-)-trans-7,8-dihydroxy-7,8-dihydrobenzo[a]pyrene [(+-)-B[a]P-7,8-diol] with 12-O-tetradecanoylphorbol-13-acetate (TPA)-stimulated human polymorphonuclear leukocytes (PMNs) elicited genotoxic effects in bacteria and mammalian cells. Structure-activity studies with various polycyclic aromatic hydrocarbon derivatives suggest that a diolepoxide intermediate(s) was being formed from this chemical-cell interaction. In this study, we demonstrate by stereochemical analysis of tetraol products that primarily anti-diolepoxides are being formed from (+-)-B[a]P-7,8-diol by TPA-stimulated PMNs with an anti/syn ratio of 6. Likewise, a myeloperoxidase (MPO)-
H2O2
system generated primarily anti-diolepoxides of B[a]P-7,8-diol with an anti/syn ratio greater than 5. Such ratios are indicative of the epoxidation of B[a]P-7,8-diol via a peroxyl radical or a ferryl oxygen transfer-mediated reaction. Addition of azide, an MPO inhibitor, resulted in decreased tetraols from B[a]P-7,8-diol by PMNs or the MPO system. These studies further support the concept that the activation of B[a]P-7,8-diol by PMNs could create a highly localized genotoxic environment which could impact on human health.
Carcinogenesis
1991 Mar
PMID:Activation of (+-)-trans-7,8-dihydroxy-7,8-dihydrobenzo[a]pyrene to diolepoxides by human polymorphonuclear leukocytes or myeloperoxidase. 184 53
Oxidative modification of genetic material has been implicated as a factor in
carcinogenesis
, particularly during promotion and progression, and therefore there is a need for sensitive detection of oxidized DNA bases. We developed a method that can be applied to DNA isolated from any source and used to simultaneously quantify oxidized nucleosides without a need to prelabel the DNA or use destructive hydrolytic procedures. This method is based on: (a) enzymatic DNA digestion; (b) HPLC separation of the resultant nucleosides; (c) acetylation of the oxidized nucleosides with [3H]Ac2O (acetic anhydride); (d) removal of the radioactive debris; and (e) quantitative analysis of tritiated nucleoside acetates by HPLC. Enzymatic DNA digestion was optimized using DNase I in the presence of Mg2+ (pH 7), followed by nuclease P1 in the presence of Zn2+ (pH 5.1) and alkaline phosphatase (pH 7.5). Analysis of DNA oxidized with
H2O2
in the presence of Fe2+/EDTA for 30 min showed that the levels of 8-OHdG (8-hydroxy-2'-deoxyguanosine) were increased 2.7-fold, HMdU (5-hydroxymethyl-2'-deoxyuridine) 3.15-fold, and FdU (5-formyl-2'-deoxyuridine) 2.5-fold. Although the (-)-isomer of cis-dTG (cis-thymidine glycol) was enhanced 2.3 times, the (+)-isomer remained virtually unchanged. Analysis of DNA isolated from epidermal cells of mice treated in vivo with the tumor promoter TPA (12-O-tetradecanoylphorbol 13-acetate) showed 4.8-, 2.7-, and 8.7-fold increases in the levels of total cis-dTG, 8-OHdG, and HMdU, respectively, and of some unknown DNA oxidation products. These results prove applicability of the 3H-postlabeling method to the analysis of DNA (and potentially RNA) isolated from many sources, including animals and humans.
...
PMID:Quantitative high-performance liquid chromatography analysis of DNA oxidized in vitro and in vivo. 188 26
A hot spot for
H2O2
/Fe-mediated mutation has been observed between bases 154 and 170 of the supF gene in the mutation reporter plasmid pZ189 [Moraes et al. (1990)
Carcinogenesis
11, 283; Akman et al. (1991) Mutat. Res. (in press)]. To further characterize this hot spot, we synthesized the 33mer d(pAAAGTGATGGTGGTGGGGGAAGGATTCGAACCT) (pZ33), which is complementary to bases 159-191 of the supF gene. pZ33 annealed spontaneously in 10 mM Tris-HCl (pH 8.0)-1 mM EDTA-100 mM NaCl at 50 degrees C into two major forms, one of which migrates more slowly than does d(pT)33 on nondenaturing 12% polyacrylamide gels. We propose that this form is a four-stranded structure stabilized by Hoogsteen-type deoxyguanosine quartets involving all deoxyguanosines of the sequence d-(pGGTGGTGGGGG) because of the following. (1) pZ33 migrates as a single form that comigrates with d(pT)33 on denaturing 20% acrylamide-8 M urea gels. (2) Annealing an equimolar mixture of 5'-32P-labeled pZ33 and the oligodeoxynucleotide d(pTTTTTTTTpZ33TTTTTTTT) (pZ49), as well as 5'-32P-labeled pZ49 and pZ33, caused the formation of four, discreet slowly migrating bands on nondenaturing 12% polyacrylamide gels. Mixing 5'-32P-labeled pZ33 with 5'-32P-labeled pZ49 resulted in five slowly migrating bands. (3) An oligodeoxynucleotide identical with pZ33 except that every deoxyguanosine has been replaced with deoxyinosine did not anneal into a slowly migrating form. (4) Dimethyl sulfate protection studies demonstrated that all deoxyguanosines of the sequence d(pGGTGGTGGGGG) were protected at N-7 in the slowly migrating form but not in single-stranded pZ33. These data suggest that a hot spot for
H2O2
/Fe-mediated base substitutions is located adjacent to a sequence that can spontaneously adopt a quadruplex structure in which deoxyguanosine quartets are Hoogsteen bonded.
...
PMID:Quadruplex DNA formation in a region of the tRNA gene supF associated with hydrogen peroxide mediated mutations. 188 27
Interactions of Ni(II) with the base moieties of 2'-deoxynucleosides and 2'-deoxynucleotides were studied by means of UV difference spectroscopy in order to elucidate the mechanisms of site-specific enhancement by Ni(II) of DNA base oxidation with active oxygen species, observed previously (Kasprzak et al., Cancer Res., 49 (1989) 5964;
Carcinogenesis
, 11 (1990) 647). The interactions were generally weak and could be quantitated only at pH 7.2-7.9. The resulting coordination binding of Ni(II) was stronger with the purine derivatives, especially these of guanine, than with pyrimidine derivatives. Also, Ni(II) interacted more strongly with the bases of 2'-deoxynucleotides than with the bases of 2'-deoxynucleosides. The apparent stability constants for the interactions calculated with the use of a non-linear regression method, equalled 102 +/- 14, 159 +/- 30 and 290 +/- 70 M-1 for Ni(II) coordinated by 5'dAMP, 5'dADP and 5'dATP, respectively, and 305 +/- 73, 191 +/- 54, and 270 +/- 28 M-1 for 5'dGMP, 5'dGDP and 5'dGTP, respectively. Stability constant for the dG Ni(II) interaction was 39 +/- 7 M-1. Interactions of Ni(II) with the bases of dA, dC, dT and the dC- and dT- mono-, di- and tri-phosphates were too weak for meaningful quantitation. The strongest relative Ni(II) interaction with dG may explain high sensitivity of the dG site at the DNA molecule to Ni(II)-mediated oxidation observed in vitro and in vivo. The present results contrast with Ni(II)-directed site specific cleavage of DNA with
H2O2
that occurs preferentially at the pyrimidine bases (Kawanishi et al.,
Carcinogenesis
, 10 (1989) 2231).
...
PMID:Mechanisms of nickel carcinogenesis. Interaction of Ni(II) with 2'-deoxynucleosides and 2'-deoxynucleotides. 191 76
A number of active oxygen species are likely implicated in the etiology or manifestation of several pathological conditions, including aging, arthritis,
carcinogenesis
, atherosclerosis, and muscular dystrophy. Ascorbate plays a key role in protecting cells against oxidative damage. Paradoxically, in the presence of Fe3+ or Cu2+, ascorbate can promote the generation of the same reactive oxygen species (.OH, O2-,
H2O2
, and ferryl ion) it is known to destroy. This prooxidant activity derives from the ability of ascorbate to reduce Fe3+ or Cu2+ to Fe2+ or Cu+, respectively, and to reduce O2 to O2-. and
H2O2
. Damage to nucleic acid and proteins results from the binding of either Fe2+ or Cu+ to metal binding sites on these macromolecules followed by reaction of the metal complexes with
H2O2
; this leads to the production of active oxygen species that attack functional groups at or near the metal binding sites.
...
PMID:Ascorbic acid and oxidative inactivation of proteins. 196 58
The aim of this study has been to define cytotoxic mechanisms that may cause clonal expansion in the liver of pre-carcinogenic cells. An in vitro model, which has been described previously, was used. Hepatocytes were isolated from carcinogen-treated rats and a high proportion of the cells were gamma-glutamyltranspeptidase (GGT)-positive. The cells were incubated in suspension and exposed to toxic agents in concentrations that induced a moderate increase in cellular leakage within 3 h. Samples were withdrawn and sampled cells were then allowed to attach to collagen-coated plates. Attached cells were stained and the ratio of GGT-positive/GGT-negative cells (GGT-ratio) was determined. The initial GGT-ratio was 10.4 +/- 4.7% and an increased ratio was taken as a sign of toxicity that resulted in a selection of GGT-positive cells. In a first series of experiments it was shown that hydroquinone and menadione increase the GGT-ratio, while diquat, sodium selenite, diethyl maleate or phorone do not. However, diethyl maleate in combination with diquat increased the GGT-ratio.
Hydrogen peroxide
(5 mM) increased the GGT-ratio as effectively as hydroquinone (0.3 mM). Lower concentrations of
H2O2
(0.05 mM) increased the GGT-ratio in GSH-depleted cells. The changes induced by hydroquinone and
H2O2
in low concentration were reversible. In another series of experiments, plates coated with antibodies against beta 1-integrin were used. An increase in the GGT-ratio was obtained with anti beta 1-integrin, but not with broad spectrum anti-rat hepatocyte or anti-rat beta 2-microglobulin antibodies as substrata. These data suggested an involvement of the beta 1-integrin in the selection. Taken together, these data indicate that GGT-positive hepatocytes are protected against GSH depletion and oxidative stress that may result in reversible receptor alterations.
Carcinogenesis
1990 Jan
PMID:gamma-Glutamyltranspeptidase-positive rat hepatocytes are protected from GSH depletion, oxidative stress and reversible alterations of collagen receptors. 196 30
The prevention of cancer by agents in our diet has led to the concept that oxygen radicals are a necessary component of a variety of human cancers including breast, colon and prostatic cancer. These cancers are putatively promoted by estradiol, bile acids and androgens. Epidemiological studies have shown that these cancers are suppressed in vegetarian populations. Vegetable components that may be responsible for this cancer prevention are Vitamin A, retinoids and protease inhibitors (PIs). These agents have been shown to suppress the formation of hydrogen peroxide in promoter-induced neutrophils. They also have been shown to block two-stage
carcinogenesis
and breast cancer when fed to animals. PIs also suppress experimentally-induced colon cancer and spontaneous liver cancer. Moreover, a new series of cancer-preventive agents, Sarcophytols (isolated by Fujiki and co-workers), are capable of suppressing two-stage
carcinogenesis
, breast and colon cancers in rodents when given in low concentrations. Sarcophytols were also active suppressors of
H2O2
formation of 12-O-tetradecanoyl-phorbol-13-acetate (TPA)-induced neutrophils. These observations point to an essential role of oxygen radicals in
carcinogenesis
. Suppression of the oxygen radical response of neutrophils in relation to cancer preventive agents is a facile assay of these important substances. The mechanism of action of oxygen radicals in promoting
carcinogenesis
is a multiple one, including: (1) activation of oncogenes, (2) modification of DNA bases, and (3) formation of single-strand breaks leading to poly(ADP)ribose polymerase activation.
...
PMID:Prevention of cancer by agents that suppress oxygen radical formation. 206 Aug 47
Active oxygen species (AOS) such as O2- and
H2O2
have been shown to be generated from both gas and tar phases of cigarette smoke and it has been suggested that they are involved in
carcinogenesis
due to cigarette smoking. Therefore, we investigated the effect of cigarette smoking on oxidative DNA damages in human peripheral blood cells using 8-hydroxydeoxy-guanosine (8-OH-dG) as a marker. From ten healthy male volunteers aged 20-22 years, 5 ml of blood was taken before and 10 minutes after smoking 2 cigarettes in 10 minutes. After lysis of blood cell membranes leukocyte DNA was isolated using a DNA extractor and 8-OH-dG levels were determined using high performance liquid chromatography (HPLC) with electrochemical detection. The mean levels of 8-OH-dG increased significantly (P less than 0.05) from 3.3 +/- 0.8/10(6) dG (mean +/- SD) to 5.1 +/- 2.5 after smoking. These results indicate that cigarette smoking induces oxidative DNA damage in peripheral blood cells in a relatively short time.
...
PMID:Cigarette smoking induces formation of 8-hydroxydeoxyguanosine, one of the oxidative DNA damages in human peripheral leukocytes. 207 46
The induction of heme oxygenase by both hydrogen peroxide and UVA (365 nm) radiation in normal human skin fibroblasts is prevented by prior treatment of cells with the specific iron chelators, o-phenanthroline or desferrioxamine. In addition, both iron chelators protected cells against the lethal effects of
H2O2
treatment or UVA irradiation. We propose that the generation of the highly reactive hydroxyl radical by an iron catalyzed Fenton reaction is involved both in the induction of this stress response and, at least in part, in cell killing by the two treatments. These results are also consistent with the idea that the heme oxygenase gene is induced in response to oxidative stress and that its induction may constitute an inducible protective mechanism against oxidative damage induced by both hydrogen peroxide and UVA radiation.
Carcinogenesis
1990 May
PMID:Induction of the heme oxygenase gene in human skin fibroblasts by hydrogen peroxide and UVA (365 nm) radiation: evidence for the involvement of the hydroxyl radical. 215 88
<< Previous
1
2
3
4
5
6
7
8
9
10
Next >>