Gene/Protein Disease Symptom Drug Enzyme Compound
Pivot Concepts: Gene/Protein Disease Symptom Drug Enzyme Compound   Target Concepts: Gene/Protein Disease Symptom Drug Enzyme Compound

---

Query: UMLS:C0596263 (carcinogenesis)
64,820 document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)

4-Aminobiphenyl (4-ABP) is a human and mouse bladder carcinogen. Epidemiological studies have shown that individuals with a slow acetylator phenotype, especially those exposed to high levels of carcinogenic aromatic amines, show an increased susceptibility to bladder cancer. In order to determine if a slow acetylator phenotype results in increased DNA damage, congenic mouse strains C57BL/6J and B6.A-Nat(s), which differ genetically at the acetyltransferase (EC 2.3.1.5) locus as homozygous rapid (Natr/Natr) and homozygous slow (Nat(s)/Nat(s)) acetylators respectively, were continuously administered 4-ABP.HCl (55-300 p.p.m.) in their drinking water for 28 days. The levels of covalently bound N-(deoxyguanosin-8-yl)-4-ABP-DNA adducts, which are believed to be critical for the initiation of tumors, were quantitated in the liver and bladder by 32P-postlabeling analysis. The levels of the hepatic DNA adduct increased with dose in both sexes, but were independent of the mouse acetylator genotype. At comparable doses, however, the levels of DNA adducts were 2-fold higher in the liver of the female as compared to the male animals. The DNA adducts also increased with dose in bladder of the male mice, but in contrast to the liver, the adduct levels were approximately 2-fold lower in the bladder DNA of the female mice. Also in contrast to the liver, the levels of bladder DNA adducts were significantly higher (P < or = 0.03) in the phenotypic rapid acetylator females compared to the slow acetylators at both 75 and 150 p.p.m. doses; the median levels of adducts were 10-20% higher in the phenotypic slow acetylator male bladders compared to their rapid acetylator counterparts. The results of these studies are consistent with the increased carcinogenicity of 4-ABP to the liver of female mice and the bladder of male mice. They further suggest that factors other than acetylator phenotype limit the extent of DNA adduct formation from 4-ABP in these mice.
Carcinogenesis 1992 Oct
PMID:DNA adduct levels in congenic rapid and slow acetylator mouse strains following chronic administration of 4-aminobiphenyl. 142 49

A quantitative method for estimation of the exposure of the food-borne carcinogen, 3-amino-1,4-dimethyl-5H-pyrido[4,3-b]indole (Trp-P-1), was developed by the analysis of its hemoglobin binding in rats. This method was then applied to show the presence of Trp-P-1-hemoglobin adducts in human blood. In rat experiments, 0.2 and 0.07% of the administered [14C]Trp-P-1 formed stable covalent adducts with blood hemoglobin and plasma proteins respectively. Subsequent strong acidic treatment (6 N HCl, 110 degrees C, 24 h) of the Trp-P-1-hemoglobin adducts cleaved peptide bonds of globin, and yielded mainly three derivatives of Trp-P-1. One of them (TPHB) represented approximately 50% of the total Trp-P-1-hemoglobin adducts and was suitable for detection through its strong fluorescence. TPHB was used as a surrogate marker of the Trp-P-1-hemoglobin adducts. Linear dose dependency of Trp-P-1 binding to liver DNA and hemoglobin in rats was confirmed by 32P-postlabeling analysis and TPHB assay. The absence of Trp-P-1-DNA adducts and TPHB in nontreated rats was also confirmed. Using TPHB as a tool for human dosimetry of Trp-P-1, human blood samples from four healthy individuals were examined. TPHB was detected in all samples ranging from 0.23 to 4.33 pmol/g hemoglobin. These results suggest human exposure to Trp-P-1, probably from cooked foods or cigarette smoke, and its possible relationship to human carcinogenesis.
Carcinogenesis 1992 Jun
PMID:Determination of human exposure to the dietary carcinogen 3-amino-1, 4-dimethyl-5H-pyrido[4,3-b]indole (Trp-P-1) from hemoglobin adduct: the relationship to DNA adducts. 160 Jun 6

Tricyclic antidepressants, such as amitriptyline (Elavil), and the nontricyclic agent, fluoxetine (Prozac), bind to growth-regulatory intracellular histamine receptors, associated with anti-estrogen binding sites in microsomes and nuclei. The prototype anti-estrogen binding site/intracellular histamine receptor ligand, N,N-diethyl-2-[4-(phenylmethyl)phenoxy]ethanamine HCl, inhibits normal cell proliferation in vitro but stimulates tumor growth in vivo. Because of their structural similarity to N,N-diethyl-2-[4-(phenylmethyl)phenoxy]ethanamine HCl, we carried out studies to determine whether amitriptyline and fluoxetine stimulate tumor growth and/or development in rodents at concentrations relevant to the treatment of human depression (equivalent human dose range, approximately 100-150 mg/day for amitriptyline and approximately 20-80 mg/day for fluoxetine). All experiments were performed blinded. In studies of growth stimulation of transplantable syngeneic tumors, groups of mice were inoculated s.c. with C-3 fibrosarcoma cells or given i.v. or s.c. injections of B16f10 melanoma cells, followed 24 h later by daily i.p. injections of saline, amitriptyline, or fluoxetine. Tumor latency (fibrosarcoma), aggregate tumor weight (s.c. injected melanoma), or time to death from pulmonary metastasis (i.v. injected melanoma) was determined; drug-induced stimulation of DNA synthesis in C-3 fibrosarcoma cells in vitro was correlated with tumor growth acceleration in vivo. In a mammary carcinogenesis model, the effects of chronic saline, amitriptyline, or fluoxetine administration on the rate and frequency of development of mammary tumors in rats fed dimethylbenzanthracene (DMBA) were compared. Eight of 20 amitriptyline- or fluoxetine-treated mice developed fibrosarcoma tumors by day 5, as compared to none of 20 saline controls (P less than 0.002). Similarly, 20 of 21 DMBA-treated rats receiving the antidepressant drugs developed 33 mammary tumors by week 15 as compared to 5 tumors in 4 of 7 DMBA-treated rats receiving saline (P less than 0.001). For both models, tumor latency decreased 30-40% and, in the DMBA model, tumor frequency increased greater than 2-fold in the antidepressant-treated rats as compared to controls. Stimulation of fibrosarcoma growth in vivo correlated with a corresponding bell-shaped drug-induced increase in DNA synthesis in vitro. While the median time to death from pulmonary metastases did not differ among groups given i.v. injections of melanoma cells, a significant (P less than 0.01) stimulation of growth of s.c. injected melanoma was observed in mice receiving the antidepressants.(ABSTRACT TRUNCATED AT 400 WORDS)
...
PMID:Stimulation of malignant growth in rodents by antidepressant drugs at clinically relevant doses. 161 49

Indole-3-carbinol [I3C, also called 3-(hydroxymethyl)indole] is a naturally occurring modulator of carcinogenesis with a biological activity that is at least partially dependent on its conversion to active substances in acidic media. We compared the identities of the major oligomeric products of I3C produced under conditions approximating those found in gastric juice with the reported identities of products of 3-substituted indoles produced under enzymatic and other nonenzymatic conditions. After a 10-min treatment in aqueous HCl solution, I3C was converted in 18% yield to a mixture of acetonitrile-soluble products, the major components of which (as determined by HPLC) were diindol-3-ylmethane (5.9%), 5,6,11,12,17,18-hexahydrocyclononal[1,2-b:4,5-b':7,8-b"]triindo le (2.0%), and [2-(indol-3-ylmethyl)indol-3-yl]indol-3-ylmethane (5.9%). Tentative assignments were made for 3,3-bis(indol-3-ylmethyl)indolenine (0.59%), a symmetrical cyclic tetramer (0.64%), and a linear tetramer (1.1%). Indolo[3,2-b]carbazole (ICZ) was formed slowly in aqueous acidic solutions in low yields (2.0 ppm) which increased to greater than 90 ppm following addition of an organic solvent [tetrahydrofuran (THF) or dimethylformamide (DMF)] to a neutralized solution. Relative yields of trimers vs dimer increased with decreasing pH and with decreasing starting concentration of I3C. Evidence is presented that ICZ formation may not involve radical intermediates as is characteristic of photodynamic processes. A mechanistic rationale is presented for the formation of the identified products.
...
PMID:Oligomerization of indole-3-carbinol in aqueous acid. 164 48

Levels of unscheduled DNA synthesis (UDS) of peripheral blood lymphocytes were measured by liquid scintigraphy in 23 patients with hepatocellular carcinoma (HCC), 42 first-degree relatives of HCC, 17 carriers of HBsAg, and 47 controls in order to evaluate the effects of HN2.HCl on the damage and repair of cell DNA, the effects of genetic susceptibility on the development of HCC, and the relationship between genetic susceptibility and hepatitis B virus (HBV) infection. The results were: 1. UDSs were significantly increased in the peripheral blood lymphocytes from patients with HCC and their first-degree relatives, and higher than those of the controls (P less than 0.005). 2. UDS in HBsAg carriers was significantly higher than that of the controls (P less than 0.05), 3. The difference of UDS was also remarkable between the HBsAg-negative patients with HCC and their first-degree relatives and the controls (P less than 0.01). These results suggest that the development of HCC might be due to the combined effects of environmental factors and genetic susceptibility. As an environmental factor, HBV infection might play role in hepato-carcinogenesis in individuals with or without a genetic background.
...
PMID:[Unscheduled DNA synthesis of peripheral blood lymphocytes in pedigrees of hepatocellular carcinoma patients]. 166 15

A simple synchronous fluorescence spectrophotometry (SFS) to detect benzo[a]pyrene-7,8-diol-9,10-epoxide (BPDE)-globin adducts is described. SFS for BPDE-DNA, which measures detached benzo[a]pyrene (B[a]P)-tetrols after acid hydrolysis of DNA, was applied for BPDE-globin adducts in B[a]P-treated C57BL/6 (B6) mice. Unlike DNA samples, globin is not measurable as such after acid hydrolysis because proteins give a background in SFS. Furthermore, proteinase incubation before acid hydrolysis of globin gave too much background even after purification to be useful in this assay. Of several purification procedures tried after acid hydrolysis (protein precipitation, elution through Sep-Pak C18, filtration, ether extraction of tetrols), the lowest background fluorescence was obtained with ether extractions of B[a] moieties. Ether phases were evaporated to dryness and the remainder dissolved in distilled water (1 ml), which was measured by SFS. Compared to DNA, somewhat milder hydrolysis conditions were optimal for globin samples (0.05 M HCl, 1.5 h, + 90 degrees C). Globin samples from B[a]P-treated mice gave a peak at the same wavelength (345 nm excitation) as the hydrolysis products of BPDE-DNA adducts, indicating B[a]P-tetrols and triols in the sample. Less than half of B[a]P measured in globin was from covalently bound BPDE. In mice injected i.p. with 1-160 mg/kg of B[a]P there was a dose-dependent increase in the amount of BPDE adducts in globin and a positive correlation with lung and liver DNA. Globin adducts were a more sensitive indicator of B[a]P exposure than DNA adducts because more globin can be used for the assay. Although both covalently and non-covalently bound BPDE in globin are detected by SFS, this method is the simplest described so far, reproducible and theoretically sensitive enough for human biomonitoring.
Carcinogenesis 1991 Dec
PMID:Benzo[a]pyrene-globin adducts detected by synchronous fluorescence spectrophotometry: method development and relation to lung DNA adducts in mice. 174 19

A hot spot for H2O2/Fe-mediated mutation has been observed between bases 154 and 170 of the supF gene in the mutation reporter plasmid pZ189 [Moraes et al. (1990) Carcinogenesis 11, 283; Akman et al. (1991) Mutat. Res. (in press)]. To further characterize this hot spot, we synthesized the 33mer d(pAAAGTGATGGTGGTGGGGGAAGGATTCGAACCT) (pZ33), which is complementary to bases 159-191 of the supF gene. pZ33 annealed spontaneously in 10 mM Tris-HCl (pH 8.0)-1 mM EDTA-100 mM NaCl at 50 degrees C into two major forms, one of which migrates more slowly than does d(pT)33 on nondenaturing 12% polyacrylamide gels. We propose that this form is a four-stranded structure stabilized by Hoogsteen-type deoxyguanosine quartets involving all deoxyguanosines of the sequence d-(pGGTGGTGGGGG) because of the following. (1) pZ33 migrates as a single form that comigrates with d(pT)33 on denaturing 20% acrylamide-8 M urea gels. (2) Annealing an equimolar mixture of 5'-32P-labeled pZ33 and the oligodeoxynucleotide d(pTTTTTTTTpZ33TTTTTTTT) (pZ49), as well as 5'-32P-labeled pZ49 and pZ33, caused the formation of four, discreet slowly migrating bands on nondenaturing 12% polyacrylamide gels. Mixing 5'-32P-labeled pZ33 with 5'-32P-labeled pZ49 resulted in five slowly migrating bands. (3) An oligodeoxynucleotide identical with pZ33 except that every deoxyguanosine has been replaced with deoxyinosine did not anneal into a slowly migrating form. (4) Dimethyl sulfate protection studies demonstrated that all deoxyguanosines of the sequence d(pGGTGGTGGGGG) were protected at N-7 in the slowly migrating form but not in single-stranded pZ33. These data suggest that a hot spot for H2O2/Fe-mediated base substitutions is located adjacent to a sequence that can spontaneously adopt a quadruplex structure in which deoxyguanosine quartets are Hoogsteen bonded.
...
PMID:Quadruplex DNA formation in a region of the tRNA gene supF associated with hydrogen peroxide mediated mutations. 188 27

1,2-Dimethylhydrazine-HCl (DMH-2HCl) is derived from the natural toxin cycasin, and is extensively used to induce cancers in experiments with rodents. We examined the toxicity of DMH-2HCl, incorporated into purified diets varying in protein, to determine concentrations compatible with long-term survival in B6C3H1 mice. Initial studies showed single-dose oral LD50 values (95% confidence intervals) of 26 (18-32) mg DMH-2HCl/kg body weight for males, and 60 (53-65) for females. A 6-wk study was performed with diets containing 10 or 40% soybean protein with doses of 0, 11.25, 22.5, 45, 90, and 180 mg DMH-2HCl/kg diet. All mice fed the highest dose were removed from the study due to severe toxicity. Declines in food consumption and body weight occurred in both sexes, accelerated with increasing log(DMH) dose, and were substantially more severe in groups fed 10% protein. A 5-mo study was subsequently performed with male mice fed 10 or 40% protein diets containing doses of 0, 15, 30, or 45 mg DMH-2HCl/kg diet. In this longer study, dose-related declines of food intake and body weight were also more pronounced with 10% protein. Histopathologic examination of samples from 29 organs/tissues revealed hepatic changes most commonly, and these were more severe at higher DMH levels. Lesions ranged from focal centrilobular hepatocellular necrosis to severe toxic hepatitis, associated with lobular disorganization and hepatocellular hypertrophy. Frequent dose-dependent lesions were also found in kidneys, adrenals, and heart. Renal changes included focal subcapsular fibrosis with atrophy, and hyperplasia of the tubular epithelium. Adrenal cortical hypertrophy was noted at the two highest DMH doses. Focal cardiac myocytolysis was also noted at high DMH doses. Renal damage occurred only rarely in the absence of liver pathology, and adrenal hypertrophy only rarely without renal damage. Cardiac myocytolysis was found in 14% of mice without hepatic, renal, or adrenal damage, but in 62% of those with lesions in each of those organs. No evidence of gastrointestinal toxicity was observed. Hepatic, renal, and adrenal lesions were more frequent and severe in mice fed the low-protein diet. The protective effect of high protein was DMH-dose dependent. The lower doses in these studies could be used to investigate effects of diet, cocarcinogens, or chemopreventative agents on carcinogenesis resulting from chronic, low-level dietary exposure to DMH.
...
PMID:Dietary protein and chronic toxicity of 1,2-dimethylhydrazine fed to mice. 201 52

The induction of oxidation and conjugation enzymes, the scavenging of carcinogen electrophiles, and the inhibition of aflatoxin B1 (AFB1) activation were examined as possible mechanisms of anti-carcinogenesis by indole-3-carbinol (I3C). Liver microsomal 7-ethoxycoumarin O-deethylase and 7-ethoxyresorufin O-deethylase activities were not induced significantly in rainbow trout fed diets containing 500-2000 ppm I3C for 8 days compared to trout fed the control diet. Furthermore, no detectable changes in the specific contents of cytochrome P-450 isozymes LM2 and LM4b, as measured by Western-blotting and immunoquantitation, were found in liver microsomes following dietary I3C administration. Dietary I3C had no significant effect on liver microsomal uridine diphosphate-glucuronyl-transferase activity, measured using the substrates 1-naphthol and testosterone, or on cytosolic glutathione S-transferase activity, measured using the substrate styrene oxide. The ability of I3C or its acid reaction products (RXM; generated by the reaction of I3C with HCl) to act as scavengers for the direct alkylating agent AFB1-8,9-Cl2 was examined. Addition of I3C or RXM to in vitro incubations did not inhibit the covalent binding of AFB1-8,9-Cl2 to calf thymus DNA. Kinetic analyses of microsome-mediated binding of AFB1 to DNA in vitro indicated that RXM inhibited the metabolic activation of AFB1. RXM increased the apparent Km for the AFB1-DNA binding reaction without changing the associated Vmax; the apparent Km values at 0, 3.5, 35, and 350 microM RXM were 35, 38, 66, and 86 microM for trout liver microsomes. RXM also inhibited the activation of AFB1 by rat liver microsomes, but I3C was not an effective inhibitor against AFB1-DNA binding mediated by either rat or trout liver microsomes. The results of the present study indicate that inhibition of microsome-activated AFB1 binding to DNA by I3C products may be of significant importance in I3C inhibition of hepatocarcinogenesis in trout and other species. The inhibition of carcinogen activation by I3C is contrasted with the mechanism of anti-carcinogenesis by beta-naphthoflavone, which involves induction of xenobiotic metabolizing enzymes.
...
PMID:Mechanisms of anti-carcinogenesis by indole-3-carbinol. Studies of enzyme induction, electrophile-scavenging, and inhibition of aflatoxin B1 activation. 210 94

Ingested nitrate and nitrite have been shown to contribute to endogenous, N-nitroso compound formation in man and experimental animals. N-nitroso compounds have long been suspected of contributing to higher levels of gastric cancer in various populations. Reconstructive gastric surgery to treat ulcers is accompanied by a change in bile reflux, gastritis and an increased incidence of gastric cancer in humans. To evaluate possible connections between gastric nitrite processing, reconstructive surgery and gastric cancer, the surgically altered domestic ferret, Mustela putorius furo, was used as an experimental model. The aim of the study was to determine if surgery would alter the stomach in a way which would increase gastric nitrite concentration, and thereby enhance the likelihood of gastric N-nitroso compound formation. Three groups of ferrets, one control group (n = 6) and two groups of surgically altered ferrets, one to simulate maximal bile reflux (MABR, n = 6), and the other to model minimal bile reflux (MIBR, n = 7), were studied. Each group's response to an exogenously administered dose of sodium nitrite did not differ significantly with respect to rate of gastric nitrite absorption, with half-lives in the 13-min range. Permeability of gastric mucosa to nitrite did not differ between controls and MIBR ferrets. Mean doubling time of gastric nitrate appeared slowed in surgically altered ferrets. Mean rate of gastric emptying was the same in the three groups, but appeared delayed initially in MIBR ferrets. Thiocyanate concentrations, pH and HCl secretion, all parameters which have been shown to affect gastric nitrite processing, did not differ significantly between groups. Gastric mucosal endoscopic biopsies obtained at 6-month intervals showed no clear difference in degree of mucosal inflammation and/or dysplasia in the three groups. These findings indicate that gastric mucosal neoplasia has not occurred in this model and that changes in parameters favoring gastric N-nitrosation, even if relevant to the disease process, are not apparent at this time.
Carcinogenesis 1990 Mar
PMID:Gastric nitrite processing in the surgically altered maximal and minimal bile reflux ferret model. 231 Nov 83


1 2 3 4 5 Next >>

---