Gene/Protein Disease Symptom Drug Enzyme Compound
Pivot Concepts:   Target Concepts:
Query: UMLS:C0476089 (endometrial cancer)
 11,379 document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)

Fourteen of fifty-three cases of endometrial carcinoma (26 per cent) contained varying, usually small numbers of argyrophil cells, as demonstrated by Grimelius silver nitrate staining of formalin-fixed paraffin-embedded sections. In eight cases the argyrophilia was present in the apical region of glandular cells (type 1 cells) or throughout the cytoplasm of glandular or squamous cells (type 2 cells). The distribution of argyrophilia in these cells closely paralleled that of mucin or glycogen, and pretreatment of the sections with disease resulted in a loss of argyrophilia in the glycogen-rich tumors. In six cases individual round, ovoid, and flask-shaped argyrophilic cells were present also within the glandular epithelium (type 3 cells). In all six cases, similarly distributed cells were positive immunohistochemically for serotonin. Immunohistochemical staining for a battery of polypeptide hormones (calcitonin, gastrin, somatostatin, adrenocorticotropin [ACTH], and neurotensin) revealed positive staining for ACTH in one of the six tumors that contained type 3 cells and positive staining for somatostatin in another. Ultrastructural examination of the ACTH- and serotonin-positive tumor disclosed cells with granules 80 nm in diameter. Types 1 and 2 argyrophil cells were found in small numbers in several specimens of normal proliferative and secretory endometrium, but type 3 argyrophil cells were not identified in these specimens. Although focal argyrophilia is a frequent feature of endometrial carcinomas (26 per cent), the presence of type 3 argyrophil cells containing hormones, as evidenced by the immunohistochemical demonstration of serotonin and occasionally polypeptide hormones, is much less common (11 per cent).
 ...
PMID:Endometrial carcinoma with argyrophil cells: a histochemical and immunohistochemical analysis. 614 92

In order to estimate the clinical significance of tissue polypeptide antigen (TPA), TPA was measured by radioimmunoassay in sera from patients with various gynecological tumors. They were 40 uterine myomas, 94 cervical cancers, 21 endometrial cancers, 3 vulval cancers, 51 benign ovarian tumors and 78 malignant ovarian tumors including 18 low potential malignant tumors (LPM). The mean TPA values in patients with benign as well as malignant tumors were significantly higher than that of 97 healthy volunteers (68 +/- 17 U/l; Upper limit; 107 U/l). Among the cervical cancer patients, serum TPA level and positive ratio became higher as the disease progressed. In the advanced cases, the mean serum TPA value and positive ratio were 149 +/- 64 U/l and 75%, respectively. The mean TPA value in the endometrial cancer patients was significantly higher than that of myoma patients. Among the patients with ovarian tumor, serum TPA was elevated in 14% of benign cases, 28% of LPM cases, 47% of stage I cases and 82% of the advanced cases. Serum TPA values varied directly with the stage and malignancy of disease. The present study revealed that TPA is a useful markers in the diagnosis of gynecological tumors, especially for ovarian cancers.
 ...
PMID:[The clinical significance of tissue polypeptide antigen (TPA) in the patients with gynecologic tumor]. 673 25

Tissue polypeptide antigen (TPA), TPS, Cyfra 21-1, Cytokeratins 8-18 (CTKRS 8-18), SCC and CA 125 were measured in blood samples drawn at diagnosis from 43 patients with endometrial cancer, 47 with cervical cancer, 11 with cervical intraepithelial neoplasia (CIN), and 236 with benign uterine disease as controls. The cut-off values for all antigens were chosen at the 95th percentile of the standard Gaussian variate of controls; these limits were 98 U/L for TPA, 127 U/L for TPS, 1.6 ng/mL for Cyfra 21-1, 1.2 ng/mL for CTKRS 8-18, 48 U/mL for CA 125, and 2.8 ng/mL for SCC. TPA had the same sensitivity as SCC for squamous cell carcinoma of the cervix (42%) and a higher sensitivity than CA 125 for endometrial cancer (40% vs 12% respectively). TPA was more sensitive than TPS for both cervical (40% vs 13%) and endometrial cancer (40% vs 21%). TPA and SCC had a higher sensitivity than Cyfra 21-1 (34%) and CTKRS 8-18 (27%) for squamous cell carcinoma of the cervix. In conclusion, as for soluble cytokeratin fragments, the serum TPA seems to be the most reliable marker for the management of cervical and endometrial cancer.
 ...
PMID:Determination of serum levels of different cytokeratins in patients with uterine malignancies. 752 Jun 82

A highly reproducible and technically straightforward technique for the isolation and long-term culture of normal human endometrial epithelial cells is described. The essential conditions for long-term culture are that the cells be seeded onto a gelatin matrix and that 'endothelial cell growth supplement' be present in the culture medium. Normal endometrial epithelial cells express cytokeratins and oestrogen receptors. They may be passaged five to six times without change in properties. Growth of normal endometrial epithelial cells was stimulated by 17-beta-oestradiol and epidermal growth factor. Expression of the mRNA coding for seven polypeptide angiogenic factors, by normal endometrial epithelial, stromal and three endometrial carcinoma lines, was examined. The endometrial epithelial and stromal cells express mRNA for the polypeptide angiogenic factors, basic fibroblast growth factor, vascular endothelial cell growth factor, transforming growth factor-beta 1 and pleiotrophin, as well as the cytokine midkine. Expression of the mRNA for both vascular endothelial growth factor and midkine by normal endometrial epithelial cells showed a 2-fold increase on treatment with a physiological dose of 17-beta-oestradiol (10(-10) M) while, in contrast, the mRNA of transforming growth factor-beta 1 decreased 4-fold on treatment with 17-beta-oestradiol (10(-10) M) and was abolished by exposure to progesterone (5 x 10(-9) M). Expression of the mRNAs for angiogenic polypeptides by the endometrial carcinoma lines was more restricted.
 ...
PMID:The isolation and long-term culture of normal human endometrial epithelium and stroma. Expression of mRNAs for angiogenic polypeptides basally and on oestrogen and progesterone challenges. 753 45

This paper reviews basic and clinical aspects of human prostate cancer, with special regard to steroid hormones and growth factors, their receptors and the use of these tools in clinical practice. Unlike other endocrine-related tumours, such as breast and endometrial cancer, human prostatic carcinoma has distinctive features that crucially hinder its definition in terms of both biological potential and clinical course. Failure of androgen receptors to represent helpful discriminants for both prognosis and treatment of prostate cancer patients may depend upon methodological pitfalls and/or the heterogeneous composition of most tumour tissues. The former involve either technical problems (tissue sampling and storage, assay procedures) or biochemical and biological points (heterogeneity and functional integrity of steroid binding sites, subcellular and tissue distribution of steroid receptors). The latter mostly concern the unique feature of both normal and diseased prostate gland to present regional diversities in hormone sensitivity and steroid receptor content. Another important area of interest resides in the potential role played by stromal-epithelial interaction in the regulation of growth and function of prostate epithelial cells. In this respect, continued growth of androgen-dependent prostate cancer cells is achieved through intricate pathways where mesenchymal steroid-induced polypeptide growth factors may act in a paracrine/autocrine fashion to mediate androgen action on tumor epithelial cells. In particular, epidermal growth factor (EGF) and transforming growth factor-a (TGFa) may serve as androgen intermediaries in the proliferative control of prostate epithelial cells, but may also be involved in androgen-independent autocrine epithelial cell growth. Clinical correlations of androgen receptors in human prostatic carcinoma have been insofal disappointing. Biochemical or histochemical assays have failed to satisfactorily predict prognosis and response to endocrine therapies of patients. This recalls problems in both methodologies and tissue suitability and points to the need of prolonged follow-up studies wherein special care is placed in sampling conditions, identification of high-affinity sites of steroid binding and selection of threshold values for receptor concentrations. Assay of the EGF receptors might provide additional contribution for a deeper inspection of the biological nature of prostate tumour tissues and help in selecting more appropriate individual-based therapeutic strategies.
 ...
PMID:Steroid receptors in prostate cancer tissues and cells: pathophysiology, problems in methodology, clinical value and controversial questions. 800 81

In view of the potential of 1,25-dihydroxyvitamin D3 [1,25(OH)2D3] as a cell-differentiation-inducing agent in endometrial cancer, the localization of the vitamin D receptor (VDR) was examined immunohistochemically in 21 endometrial adenocarcinoma specimens, and the effect of 1,25(OH)2D3 on cell growth, as well as the phenotypic changes for cell maturation after treatment with 1,25(OH)2D3, was investigated in 2 endometrial carcinoma cell lines (AMEC-1, RL95-2). The VDR was detected in 14 of the 21 endometrial carcinoma specimens. The growth of RL95-2 cells expressing VDR was inhibited to 44% when cultured with 50 nM 1,25(OH)2D3 for 6 days. In contrast, the growth of AMEC-1 cells not expressing VDR was completely uninhibited even when cultured with 100 nM 1,25(OH)2D3 for 6 days. The RL95-2 cells exposed to 50 nM 1,25(OH)2D3 for 6 days had an increasing expression for 52.5 kD or 45 kD cytokeratin polypeptide, and they became columnar with pronounced polarity and formed gland-like structures when cultured in collagen gel. These results suggest that endometrial adenocarcinoma is a target for 1,25(OH)2D3, which appears to function as a cell-differentiation-inducing agent for the treatment of endometrial cancer.
 ...
PMID:Vitamin D receptor in endometrial carcinoma and the differentiation-inducing effect of 1,25-dihydroxyvitamin D3 on endometrial carcinoma cell lines. 903 42

Accumulating evidence suggests that uterine luminal fluids contain a variety of polypeptide growth factors and cytokines that, it is speculated, have roles in the development, growth and differentiation of the uterus and, during pregnancy, in the growth and survival of the embryo. Although epidermal growth factor (EGF) has previously been identified by radioimmunoassay and immunohistochemistry in the pig uterus, there have been no detailed studies of the secreted EGF protein. EGF was therefore purified from uterine flushings and uterine fluids of nonpregnant pigs of mixed breed using a variety of ion-exchange chromatography steps. Uterine flushings and fluids contained an anionic factor(s) that at 4 degrees C competed with 125I-labelled mouse EGF for binding to EGF receptors on an endometrial carcinoma cell line and stimulated DNA synthesis in Balb/c mouse 3T3 fibroblasts. As analysed by gel filtration, uterine fluids contained a 3-6 kDa factor that stimulated 3T3 cell DNA synthesis and was a competitor of cellular 125I-labelled EGF binding. Gel filtration further revealed that uterine flushings and fluids contained, respectively, 45 kDa and 40-70 kDa moieties that were mitogenic and that bound to the EGF receptor. SDS-PAGE and western blotting using an antiserum specific for pig EGF revealed immunoreactive forms of EGF of approximately 25 kDa in partially purified uterine flushings. It is concluded that uterine secretory EGF occurs, at least in part, as high molecular mass proteins. The ability of these high molecular mass EGFs to bind to and activate the EGF receptor suggests that they may be authentic ligands for the EGF receptor in utero.
 ...
PMID:High molecular mass forms of epidermal growth factor in pig uterine secretions. 903 91

Serum cancer antigen (CA) 125, CA15.3, CA19.9, carcinoembryonic antigen and tissue polypeptide antigen were analyzed in 100 normal subjects, 47 patients with benign gynaecological diseases and 97 patients with endometrial cancer. The incidence of individual elevated tumour markers (> 2SD) was 21.5-30.9% in cancer patients. Elevations of CA125 and CA15.3 were significantly associated with poor prognostic clinical factors. Univariate anaylses showed that elevated CA125, CA15.3 and CA19.9 were significantly associated with shorter survival. In multivariate analysis, CA15.3 was highly significant and had a larger hazard ratio. In conclusion, CA15.3 is a useful marker for the prognosis of patients with endometrial cancer.
 ...
PMID:Prognostic significance of tumour markers in endometrial cancer. 921 9

The mouse lactoferrin gene promoter includes a CAAT/GT box, GGGCAATAGGGTGGGGCCAGCCC, which functions as the epidermal growth factor response element (EGFRE) in human endometrial carcinoma RL95-2 cells (RL95). A positive clone, EGFREB, of 2575 bp length, was isolated from an expression library of RL95 cells with a multimer of the EGFRE sequence. In this work, we have identified that EGFREB encodes the C-terminus of Kruppel-like factor 5 (KLF5). This mRNA is most abundant in human colon and small intestine. A full-length cDNA clone was isolated from a human colon library using EGFREB as the hybridization probe. The full-length cDNA consists of 3336 bp with a 302 bp 5'-UTR, a 1663 bp 3'-UTR, and a 1371 bp sequence coding for a 457 amino acid polypeptide. Based on its tissue distribution and sequence homology to the mouse IKLF, we renamed this protein IKLF. DNase I footprinting and electrophoresis mobility shift assay confirmed the binding of IKLF to the EGFRE. The human IKLF gene spans >20 kb in length and is organized into four exons, whose intron/exon junctions follow the GT/AG rule. The three zinc fingers are encoded by three exons. Nuclear localization of IKLF was demonstrated by green fluorescence protein (GFP)-tagged IKLF in transfection experiments and western analysis. Overexpression of IKLF in RL95 cells represses the activity of reporter constructs containing the CAAT/GT box of the mouse lactoferrin gene. These findings imply that IKLF is a nuclear transcription factor that binds to the CAAT/GT box, and functions as a modulator of the mouse lacto-ferrin gene promoter activity.
 ...
PMID:Isolation and characterization of a gene encoding human Kruppel-like factor 5 (IKLF): binding to the CAAT/GT box of the mouse lactoferrin gene promoter. 1057 82

Hereditary non-polyposis colorectal cancer (or Lynch syndrome) is an autosomal dominant disease in which early onset colorectal carcinomas aggregate in families together with tumours of other organs. The genetic basis of the syndrome has been clarified with the identification of mutations in several DNA mismatch repair genes (MSH2, MLH1, PMS1, PMS2 and MSH6). We describe the clinical features and molecular characterization of a large hereditary non-polyposis colorectal cancer family which has been followed for almost 10 years. The kindred showed a striking aggregation of colorectal tumours in 3 successive generations; most of these neoplasms developed before the age of 50 years and were localized in the proximal colon. Molecular tests (carried out in ten individuals) showed specific alterations at the MLH1 gene, consisting in the insertion of a T nucleotide between bases 2,269 and 2,270; the mutation caused frameshift of the open reading frame and synthesis of a polypeptide longer than normal. The only tumour that could be analysed was positive for microsatellite instability. Physicians should become more confident with hereditary tumours and their implications, which are not limited to a single individual but concern all family members at risk of cancer. This family approach is different, and requires more expertise than the traditional individual approach. Common problems encountered in Hereditary Non-polyposis Colorectal Cancer families include: A) poor collaboration of subjects at risk (a situation which may cause some conflict between the doctor's duty to inform patients about their risk of disease and the rights of patients to choose and decide about their health); B) definition of the most appropriate surveillance programme for a given family (how many investigations to propose to the patients, and how often); C) possible interaction between genes and environmental factors (for instance, a gene carrier--in this family--developed an endometrial carcinoma after standard tamoxifen adjuvant therapy for breast cancer).
 ...
PMID:Clinical and molecular diagnosis of hereditary non-polyposis colorectal cancer: problems and pitfalls in an extended pedigree. 1057 66


<< Previous 1 2 3 Next >>