Gene/Protein Disease Symptom Drug Enzyme Compound
Pivot Concepts:   Target Concepts:
Query: UMLS:C0476089 (endometrial cancer)
11,379 document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)

The mouse lactoferrin gene promoter includes a CAAT/GT box, GGGCAATAGGGTGGGGCCAGCCC, which functions as the epidermal growth factor response element (EGFRE) in human endometrial carcinoma RL95-2 cells (RL95). A positive clone, EGFREB, of 2575 bp length, was isolated from an expression library of RL95 cells with a multimer of the EGFRE sequence. In this work, we have identified that EGFREB encodes the C-terminus of Kruppel-like factor 5 (KLF5). This mRNA is most abundant in human colon and small intestine. A full-length cDNA clone was isolated from a human colon library using EGFREB as the hybridization probe. The full-length cDNA consists of 3336 bp with a 302 bp 5'-UTR, a 1663 bp 3'-UTR, and a 1371 bp sequence coding for a 457 amino acid polypeptide. Based on its tissue distribution and sequence homology to the mouse IKLF, we renamed this protein IKLF. DNase I footprinting and electrophoresis mobility shift assay confirmed the binding of IKLF to the EGFRE. The human IKLF gene spans >20 kb in length and is organized into four exons, whose intron/exon junctions follow the GT/AG rule. The three zinc fingers are encoded by three exons. Nuclear localization of IKLF was demonstrated by green fluorescence protein (GFP)-tagged IKLF in transfection experiments and western analysis. Overexpression of IKLF in RL95 cells represses the activity of reporter constructs containing the CAAT/GT box of the mouse lactoferrin gene. These findings imply that IKLF is a nuclear transcription factor that binds to the CAAT/GT box, and functions as a modulator of the mouse lacto-ferrin gene promoter activity.
...
PMID:Isolation and characterization of a gene encoding human Kruppel-like factor 5 (IKLF): binding to the CAAT/GT box of the mouse lactoferrin gene promoter. 1057 82

Genome-wide association studies (GWASs) have discovered numerous single nucleotide polymorphisms (SNPs) associated with human complex disorders. However, functional characterization of the disease-associated SNPs remains a formidable challenge. Here we explored regulatory mechanism of a SNP on chromosome 9p21 associated with endometriosis by leveraging "allele-specific" functional genomic approaches. By re-sequencing 1.29 Mb of 9p21 region and scrutinizing DNase-seq data from the ENCODE project, we prioritized rs17761446 as a candidate functional variant that was in perfect linkage disequilibrium with the original GWAS SNP (rs10965235) and located on DNase I hypersensitive site. Chromosome conformation capture followed by high-throughput sequencing revealed that the protective G allele of rs17761446 exerted stronger chromatin interaction with ANRIL promoter. We demonstrated that the protective allele exhibited preferential binding affinities to TCF7L2 and EP300 by bioinformatics and chromatin immunoprecipitation (ChIP) analyses. ChIP assays for histone H3 lysine 27 acetylation and RNA polymerase II reinforced the enhancer activity of the SNP site. The allele specific expression analysis for eutopic endometrial tissues and endometrial carcinoma cell lines showed that rs17761446 was a cis-regulatory variant where G allele was associated with increased ANRIL expression. Our work illuminates the allelic imbalances in a series of transcriptional regulation from factor binding to gene expression mediated by chromatin interaction underlie the molecular mechanism of 9p21 endometriosis risk locus. Functional genomics on common disease will unlock functional aspect of genotype-phenotype correlations in the post-GWAS stage.
...
PMID:Allelic Imbalance in Regulation of ANRIL through Chromatin Interaction at 9p21 Endometriosis Risk Locus. 2705 16