Gene/Protein
Disease
Symptom
Drug
Enzyme
Compound
Pivot Concepts:
Gene/Protein
Disease
Symptom
Drug
Enzyme
Compound
Target Concepts:
Gene/Protein
Disease
Symptom
Drug
Enzyme
Compound
Query: UMLS:C0476089 (
endometrial cancer
)
11,379
document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)
The mouse
lactoferrin
gene responded to forskolin, 12-O-tetradecanoyl phorbol-13-acetate, and epidermal growth factor (EGF) stimulation via two adjacent enhancer elements, the cAMP response element (CRE) and EGF response element (EGFRE), collectively referred to as the mitogen response unit. In this report, we examined the minimal promoter and enhancer elements of the mouse
lactoferrin
gene that are required for EGF-induced transcriptional activation. We found that the CRE and noncanonical TATA box (ATAAA) are the minimal promoter elements for basal activity of the chloramphenicol acetyltransferase (CAT) reporter construct whereas the EGFRE is needed for an additional activity induced by EGF in transiently transfected human
endometrial carcinoma
RL95-2 cells (RL95-2). The EGFRE, however, did not function in heterologous promoters [SV 40 and thymidine kinase (TK)]. Therefore, EGF-stimulated
lactoferrin
gene activity is promoter specific in RL95-2 cells. In transiently transfected cells, EGF and forskolin showed synergistic effects on the CAT reporter that contained both response elements. Mutation made at either element or insertion of extra nucleotides between the two elements severely affected EGF-stimulated activity. Nuclear protein prepared from RL95-2 cells formed three complexes (A, B, and C) with the oligonucleotides containing both EGFRE and CRE in electrophoretic mobility shift assay. A new complex (E) was detected with the nuclear protein of EGF-treated cells. By oligonucleotide competition experiments, we demonstrated that the complex E was generated by protein bound to CRE. EGF-induced binding activity could be abolished by calf intestinal alkaline phosphatase but not by the protein synthesis inhibitor, cycloheximide. Therefore, binding of a preexisting phosphoprotein to the CRE region could be one of the requirements for EGF-induced mouse
lactoferrin
gene promoter activity.
...
PMID:Promoter-specific activation of mouse lactoferrin gene by epidermal growth factor involves two adjacent regulatory elements. 877 33
We have previously demonstrated that
lactoferrin
(LF) is a major estrogen-inducible protein in the mouse uterus. The increase of LF mRNA after estrogen treatment (> 300 fold) is the result of a complex interplay among transcription factors acting on the estrogen response element (ERE) of the LF gene. Two transcription factors-the estrogen receptor (ER) and the chicken ovalbumin upstream promoter transcription factor (COUP-TF)-play opposing roles in the estrogen responsiveness of the LF gene promoter-reporter constructs in transiently transfected human
endometrial carcinoma
cells. The ratio of ER/COUP-TF in the transfected cells appears to be critical for estrogen-stimulated LF gene promoter activity (Liu et al, 1993). In the current study, ER and COUP-TF mRNA levels are examined and related to LF mRNA expression in various mouse tissues, including the developing uterus with/without estrogen stimulation. Results show that LF mRNA and protein are expressed in various tissues during development, but the potent synthetic estrogen, diethylstilbestrol (DES), does not increase LF mRNA expression in nonreproductive tissues such as liver, spleen, and lung. In contrast, in developing neonatal reproductive tract tissues, DES increases LF mRNA and protein expression as previously reported in immature and mature uterine tissues. DES, however, did not affect ER and COUP-TF expression in developing uterine tissues. Although the uterus has a high ratio of ER/COUP-TF as compared to other tissues examined, COUP-TF may not be the only regulator for LF gene expression in this particular tissue since COUP-TF remains constant during development and following DES treatment. These data point to the complexity of differential expression of LF gene in estrogen responsive and nonresponsive tissues during development.
...
PMID:Estrogenic effect on the expression of estrogen receptor, COUP-TF, and lactoferrin mRNA in developing mouse tissues. 887 65
In vitro studies of endometrial carcinogenesis have been hampered by dedifferentiation of the cells in culture. Using the
endometrial carcinoma
cell line HEC-1B(L), we aimed to establish and characterize culture conditions that preserve a more differentiated state of the tumor cells. HEC-1B(L) cells grown in a serum-free defined medium on plastic (PL/SFDM) on top of a reconstituted basement membrane (Matrigel, MG/SFDM) or in a thick layer of Matrigel showed pronounced morphological differentiation as compared with HEC-1B(L) cells cultured on plastic in a medium containing serum (PL/10% FCS). Features of differentiation included cuboidal to columnar cell shape and an increase of rough endoplastic reticulum in Matrigel cultures. Gene expression of HEC-1B(L) cells was studied by metabolic [35S]methionine labeling and SDS-gel electrophoresis. HEC-1B(L) cells cultured in the presence of Matrigel showed two additional secretory proteins approximately 31 kD and 77 kD in size. rt-PCR was used to screen cell cultures for the presence of estrogen receptor, progesterone receptor, and
lactoferrin
-mRNA, genes typically expressed by normal endometrial epithelium. We found no expression of the estrogen receptor or progesterone receptor.
Lactoferrin
-mRNA was present under all culture conditions tested. Our results suggest a regulatory role of the extracellular matrix for the differentiation of the HEC-1B(L) cell line.
...
PMID:Basement membrane induced differentiation of HEC-1B(L) endometrial adenocarcinoma cells affects both morphology and gene expression. 921 25
Estrogen receptor-like 1a (ESRL1a; same as estrogen receptor-related orphan receptors, ERR1) belongs to a subfamily of the nuclear receptor superfamily. We have previously shown that human ESRL1a modulates estrogen responsiveness of the
lactoferrin
gene promoter in transiently transfected
endometrial carcinoma
RL95-2 cells. In this study, we cloned and characterized the human ESRL1 gene. Through the fluorescence in situ hybridization method, the ESRL1 gene was localized to the centromere region of chromosome 11q12. Partial sequencing, restriction mapping, and PCR analysis revealed that the ESRL1 gene consists of seven exons and is approximately 20 kb in length. We found that the smallest exon (exon 3) contains 117 bp and the largest exon (exon 7) has 1032 bp. The smallest intron (intron 5) is only 88 bp long and the largest intron (intron 2) is 8 kb long. All introns have the conserved GT and AG dinucleotides present at the donor and acceptor sites, respectively. Like the estrogen receptor, the highly conserved DNA-binding domain of hESRL1a is encoded by exon 2 and exon 3, and the intron/exon junctions (2 and 3) are well conserved between the two genes. Primer extension analysis revealed multiple transcription initiation start sites in human uterine (HeLa, HEC, and RL95-2) cell lines. However, one major initiation start site was found by RNase protection assay. The hESRL1a mRNA is differentially expressed in various human tissues. The nucleotide sequence adjacent to the transcription start sites of the ESRL1 lacks the typical TATA and CAAT boxes but is GC rich and contains 10 consensus Sp1-binding elements and two E boxes. The region that contains these transcription factor-binding elements showed a high level of promoter activity when transiently transfected into RL95-2 cells.
...
PMID:Human estrogen receptor-like 1 (ESRL1) gene: genomic organization, chromosomal localization, and promoter characterization. 928
Estrogen exerts a variety of biological effects on human reproductive tissues. However, little is understood about the estrogenic effect on human endometrial cells in vitro. This study was designed to investigate estrogen action on c-myc and c-fos oncogenes and
lactoferrin
gene expression in human
endometrial carcinoma
RL95-2 cells. The results indicate that estrogen can induce c-myc oncogene expression in 4 h. Neither c-fos nor the
lactoferrin
messenger was detectable, nor could they be induced by estrogen. Transfection with human estrogen receptor expression vector to the RL95-2 cells does not restore the estrogen responsiveness. In addition to estrogen, epidermal growth factor (EGF) and tumor promoter 12-O-tetradecanoylphorbol 13-acetate (TPA) can also induce c-myc expression with no effect on c-fos or
lactoferrin
expression. Our data suggest that the c-myc oncogene in human
endometrial carcinoma
RL95-2 cells is the sensitive target gene for steroid hormone and growth factor action.
...
PMID:Identification of the estrogen sensitive marker in human endometrial carcinoma RL95-2 cells. 939 49
Estrogen receptor-related orphan receptor alpha 1 is a member of the steroid/thyroid nuclear receptor superfamily. We have previously cloned the human estrogen receptor-related orphan receptor alpha 1 (hERR alpha 1) cDNA and demonstrated that it enhances estrogen responsiveness of the
lactoferrin
gene promoter in transfected human
endometrial carcinoma
cells. In the present study, we used the hERR alpha 1 cDNA as a probe and isolated the mouse homologue of ERR alpha 1 from the cDNA libraries of the brain and kidney. Sequence comparison between human and mouse ERR alpha 1 (mERR alpha 1) revealed that the homologies are 89% in nucleotides and 97% in amino acids. By electrophoresis mobility shift assay, we showed that the glutathione S-transferase-mERR alpha 1 fusion protein produced in a bacterial system bound to the human ERR alpha 1 DNA-binding element. Mouse uterine nuclear extract also interacted with this DNA element and produced three complexes in the mobility shift assay, one of which was supershifted by the hERR alpha 1 antiserum. A 2.2 kbp transcript was detected by Northern analysis in all adult mouse tissues tested; however, large variations in the amount of ERR alpha 1 mRNA were found among them. Multiple immunoreactive forms of mouse ERR alpha 1 were detected by Western analysis in non-reproductive tissues, whereas a major 53 kDa protein was found in reproductive tissues such as uterus, cervix and vagina. Diethylstilbestrol (DES) stimulated the expression of ERR alpha 1 mRNA in the uterus of 19-day-old mouse. We showed that DES and estradiol, but not progesterone or dexamethasone, enhanced the level of immunoreactive ERR alpha 1 in the mouse uterus. These results demonstrated that the ERR alpha 1 is an estrogen-responsive gene in the mouse uterus and provides a model system with which to study the biological roles of this nuclear orphan receptor.
...
PMID:The mouse estrogen receptor-related orphan receptor alpha 1: molecular cloning and estrogen responsiveness. 946 Jun 51
Expression of the
lactoferrin
gene in a variety of tissues is regulated differentially. We have previously demonstrated that the
lactoferrin
gene is regulated by estrogen and mitogen in mouse uterus. The mouse
lactoferrin
gene responded to forskolin, cAMP, TPA and EGF stimulation via two adjacent enhancer elements, the CRE and EGFRE and collectively referred to as the Mitogen Response Unit (MRU). We found that CRE is responsible for forskolin, cAMP and TPA whereas EGFRE is for EGF stimulation. We examined the minimal promoter and enhancer elements of the mouse
lactoferrin
gene that are required for EGF induced transcriptional activation. We found that the CRE and noncanonical TATA box (ATAAA) are the minimal promoter elements for basal activity of the CAT reporter construct, whereas, the EGFRE is needed for an additional activity induced by EGF in transiently transfected human
endometrial carcinoma
RL95-2 cells (RL95-2). The EGFRE, however, did not function in heterologous promoters (SV 40 and TK). Therefore, EGF-stimulated
lactoferrin
gene activity is promoter specific in RL95-2 cells. Mutation made at either elements or insertion of extra nucleotides between the two elements, severely affected EGF-stimulated activity. Nuclear protein prepared from RL95-2 cells protected the EGFRE, CRE and noncanonical TATA from DNAase I digestion in a footprinting analysis. Nuclear protein which interacted with the CRE were previously identified as API and CREB. In this study, we isolated a cDNA clone from an RL95-2 expression library that encodes the EGFRE binding protein. Partial sequence of the cDNA clone revealed 100% nucleotide identity with a GC-box binding protein, BTEB2. Protein-protein interaction among the transcription factors could fine-tune the mouse
lactoferrin
expression in various tissues.
...
PMID:Mouse lactoferrin gene. Promoter-specific regulation by EGF and cDNA cloning of the EGF-response-element binding protein. 978 44
Lactoferrin
(LF) is a member of the transferrin gene family. Its expression in the mouse uterus is regulated by estrogen and epidermal growth factor (EGF). The author et al. cloned the LF gene promoter/enhancer region, and demonstrated that multihormone signaling pathways are involved in modulating LF gene activity. Three short but complex modules, within 400 bp from the transcription initiation site of the mouse LF gene, contain the response elements that are responsible for estrogen, retinoic acid, mitogen, and growth factor stimulation. These elements have been identified and characterized, using reporter constructs transiently transfected into human
endometrial carcinoma
RL95-2 cells. The author et al. used molecular approaches, such as deletion, insertion, and site-directed mutagenesis, to determine the relationship between the response elements, and to fine-map the crucial nucleotides within them. This article reviews the characterization of the estrogen and EGF response elements of the mouse LF gene promoter.
...
PMID:Regulation of lactoferrin gene expression by estrogen and epidermal growth factor: molecular mechanism. 1050 67
The mouse
lactoferrin
gene promoter includes a CAAT/GT box, GGGCAATAGGGTGGGGCCAGCCC, which functions as the epidermal growth factor response element (EGFRE) in human
endometrial carcinoma
RL95-2 cells (RL95). A positive clone, EGFREB, of 2575 bp length, was isolated from an expression library of RL95 cells with a multimer of the EGFRE sequence. In this work, we have identified that EGFREB encodes the C-terminus of Kruppel-like factor 5 (KLF5). This mRNA is most abundant in human colon and small intestine. A full-length cDNA clone was isolated from a human colon library using EGFREB as the hybridization probe. The full-length cDNA consists of 3336 bp with a 302 bp 5'-UTR, a 1663 bp 3'-UTR, and a 1371 bp sequence coding for a 457 amino acid polypeptide. Based on its tissue distribution and sequence homology to the mouse IKLF, we renamed this protein IKLF. DNase I footprinting and electrophoresis mobility shift assay confirmed the binding of IKLF to the EGFRE. The human IKLF gene spans >20 kb in length and is organized into four exons, whose intron/exon junctions follow the GT/AG rule. The three zinc fingers are encoded by three exons. Nuclear localization of IKLF was demonstrated by green fluorescence protein (GFP)-tagged IKLF in transfection experiments and western analysis. Overexpression of IKLF in RL95 cells represses the activity of reporter constructs containing the CAAT/GT box of the mouse
lactoferrin
gene. These findings imply that IKLF is a nuclear transcription factor that binds to the CAAT/GT box, and functions as a modulator of the mouse lacto-ferrin gene promoter activity.
...
PMID:Isolation and characterization of a gene encoding human Kruppel-like factor 5 (IKLF): binding to the CAAT/GT box of the mouse lactoferrin gene promoter. 1057 82
The human estrogen receptor (ERalpha) and the human estrogen receptor-related receptor (ERRalpha1, NR3B1a) are members of the steroid/thyroid hormone receptor superfamily. We previously cloned an isoform of ERRalpha1 cDNA and demonstrated that ERRalpha1 binds to the human
lactoferrin
gene promoter and enhances estrogen responsiveness during transient transfection experiments. In this study, we show that ERRalpha1 and ERalpha may interfere in each other's transcriptional activity by competition for binding and coactivator. A VP16-ERRalpha1 chimera was constructed and transiently transfected into human
endometrial carcinoma
HEC-1B cells. This chimera activated reporter constructs containing the human
lactoferrin
gene estrogen response element (ERE) and the synthetic palindromic 3X-ERE, suggesting that ERRalpha1 binds to these EREs. Therefore, ERRalpha1 can compete with ERalpha for binding to the same EREs. ERRalpha1 is organized into modules which include a N-terminal region that shows repression function, a Zn-finger region that binds DNA and an activation region at the C terminus. The activation function of ERRalpha1 was mapped to the conserved AF2 region in the C-terminus by deletion analysis. The transactivation activity of ERRalpha1 can be enhanced by coactivator (SRC-1a) and suppressed by ERalpha in the presence of estrogen, suggesting that SRC-1a is required by both receptors for their activity. The repression of ERRalpha1 activation function by estrogen bound ERalpha, however, could not be reversed by increasing concentration of SRC-1a in the cells. This finding is consistent with the squelching phenomenon that exists between ERalpha and other steroid receptor family members. The studies demonstrated that ERRalpha1 and ERalpha may potentially regulate the same target gene independently as well as interfere with each other's functional activity by competition for binding and coactivator.
...
PMID:Estrogen receptor alpha and estrogen receptor-related receptor alpha1 compete for binding and coactivator. 1116 56
1
2
Next >>