Gene/Protein Disease Symptom Drug Enzyme Compound
Pivot Concepts:   Target Concepts:
Query: UMLS:C0476089 (endometrial cancer)
 11,379 document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)

Accumulating evidence suggests that uterine luminal fluids contain a variety of polypeptide growth factors and cytokines that, it is speculated, have roles in the development, growth and differentiation of the uterus and, during pregnancy, in the growth and survival of the embryo. Although epidermal growth factor (EGF) has previously been identified by radioimmunoassay and immunohistochemistry in the pig uterus, there have been no detailed studies of the secreted EGF protein. EGF was therefore purified from uterine flushings and uterine fluids of nonpregnant pigs of mixed breed using a variety of ion-exchange chromatography steps. Uterine flushings and fluids contained an anionic factor(s) that at 4 degrees C competed with 125I-labelled mouse EGF for binding to EGF receptors on an endometrial carcinoma cell line and stimulated DNA synthesis in Balb/c mouse 3T3 fibroblasts. As analysed by gel filtration, uterine fluids contained a 3-6 kDa factor that stimulated 3T3 cell DNA synthesis and was a competitor of cellular 125I-labelled EGF binding. Gel filtration further revealed that uterine flushings and fluids contained, respectively, 45 kDa and 40-70 kDa moieties that were mitogenic and that bound to the EGF receptor. SDS-PAGE and western blotting using an antiserum specific for pig EGF revealed immunoreactive forms of EGF of approximately 25 kDa in partially purified uterine flushings. It is concluded that uterine secretory EGF occurs, at least in part, as high molecular mass proteins. The ability of these high molecular mass EGFs to bind to and activate the EGF receptor suggests that they may be authentic ligands for the EGF receptor in utero.
 ...
PMID:High molecular mass forms of epidermal growth factor in pig uterine secretions. 903 91

Growth factor regulation of normal and cancerous cell proliferation has been well-documented and may be mediated by proto-oncogene activity. The purpose of this study was to assess changes in proliferation and mitogen-induced c-fos mRNA expression of an endometrial carcinoma cell line, HEC-1-A, in response to TGF-beta, a potent growth-inhibitory peptide. HEC-1-A cells were incubated in the presence or absence of TGF-beta. Mitogen-stimulated cells were additionally treated with epidermal growth factor (EGF). Changes in proliferation were measured by [3H]thymidine uptake assays. Alterations in EGF-induced c-fos expression following TGF-beta pretreatment were assessed by Northern blot using a 32P-labeled human c-fos probe. Finally, chloramphenicol acetyltransferase assays were performed to evaluate c-fos promoter activity in response to treatment conditions. Basal and EGF-stimulated proliferation was inhibited by TGF-beta in a dose- and time-dependent manner. TGF-beta also reversibly decreased EGF-induced c-fos mRNA expression in a dose- and time-dependent manner. Sequences in the c-fos promoter that were stimulated by EGF showed suppressed activity when preincubated with TGF-beta. These results show that TGF-beta negatively modulates EGF-induced c-fos expression, which may be related to the observed inhibition of carcinoma cell proliferation.
 ...
PMID:Transforming growth factor-beta negatively modulates proliferation and c-fos expression of the human endometrial adenocarcinoma cell line HEC-1-A. 910 92

Previous studies from this laboratory have shown that epidermal growth factor (EGF) and the tumor promoter, phorbol myristate acetate (PMA), are mitogenic in the endometrial cancer cell line HEC-1-A. Since the effects of EGF have been shown to be mediated by the protein kinase C (PKC) pathway transduction system, we examined the possibility that the EGF-responsive signal in the endometrial cancer cell line HEC-1-A involves protein kinase C activation. HEC-1-A cells were grown to confluency in 100-mm dishes and maintained in a serum-free medium for 24 hr prior to treatment. The cells were treated with EGF at varying time intervals (0.25 to 60 min) and concentrations (0.1 to 200 ng/ml). The cells were then lysed, homogenized, and centrifuged at 105,000g for 1 hr at 4 degrees C. The supernatant was chromatographed on DEAE-Sephacel columns. The membranous pellet was resuspended in 5 ml of lysis buffer containing 1% Nonidet P-40 and also chromatographed on DEAE-Sephacel columns separately. The eluates were collected and assayed for protein kinase C activity by determining the amount of 32P transferred from [gamma-32P]ATP onto histones in the presence of the phospholipids, phosphatidylserine, and diolein. Our results show that the cytoplasmic and membrane fraction of the HEC-1-A cell line contained phosphotransferase activity which displayed kinetic characteristics typical of the protein kinase C enzyme. The optimal incubation time for protein kinase C activation in the cytosol by EGF was 5 min (30-fold stimulation). The protein kinase C activity was increased when the cell lines were incubated with increasing concentrations of EGF. Enzyme saturation was seen at a concentration of 10 ng/ml of EGF (4.5-fold stimulation). Western blot analysis confirmed the presence of the PKC enzyme in the cytosol and membranes of our cancer cell line. These results suggest that EGF, at least partially, exerts its effects on the endometrial adenocarcinoma cell line by activating protein kinase C through increased breakdown of phosphatidyl inositol (PI). The PI cascade appears to be an important signal transduction system mediating the growth stimulatory effects of EGF on endometrial carcinoma.
 ...
PMID:Epidermal growth factor activates protein kinase C in the human endometrial cancer cell line HEC-1-A. 934 55

Estrogen exerts a variety of biological effects on human reproductive tissues. However, little is understood about the estrogenic effect on human endometrial cells in vitro. This study was designed to investigate estrogen action on c-myc and c-fos oncogenes and lactoferrin gene expression in human endometrial carcinoma RL95-2 cells. The results indicate that estrogen can induce c-myc oncogene expression in 4 h. Neither c-fos nor the lactoferrin messenger was detectable, nor could they be induced by estrogen. Transfection with human estrogen receptor expression vector to the RL95-2 cells does not restore the estrogen responsiveness. In addition to estrogen, epidermal growth factor (EGF) and tumor promoter 12-O-tetradecanoylphorbol 13-acetate (TPA) can also induce c-myc expression with no effect on c-fos or lactoferrin expression. Our data suggest that the c-myc oncogene in human endometrial carcinoma RL95-2 cells is the sensitive target gene for steroid hormone and growth factor action.
 ...
PMID:Identification of the estrogen sensitive marker in human endometrial carcinoma RL95-2 cells. 939 49

Conventional chemotherapy produces varying degrees of response in patients with many advanced cancers and has significant side effects. Receptors for luteinizing hormone-releasing hormone (LH-RH) are present in a high percentage of human ovarian, prostatic, breast and endometrial tumors and targeted chemotherapy based on cytotoxic analogs of LH-RH might yield better results. The present study was undertaken to determine whether human cancer cell lines express mRNA for LH-RH receptors and epidermal growth factor (EGF) receptors. Using radioligand binding studies, we showed the presence of high-affinity binding sites for LH-RH and EGF in the membranes of human ovarian, prostatic, breast and endometrial cancer cell lines as well as in the JAR choriocarcinoma cell line. The expression of the mRNA for LH-RH receptors and EGF receptors in these cell lines was demonstrated by RT-PCR using specific primers and by subsequent Southern blot analysis. The PCR products obtained were of the expected size, 319 bp for LH-RH receptors and 400 bp for EGF receptors. These findings support the view that cytotoxic analogs of LH-RH could be used for targeted chemotherapy of these cancers. Moreover, the results suggest that these human cancer cell lines might have local regulatory systems for their proliferation based on LH-RH and EGF. Further investigations are required to elucidate the signal transduction pathways involved in the effects of cytotoxic LH-RH analogs on human tumors.
 ...
PMID:Expression of mRNA for luteinizing hormone-releasing hormone receptors and epidermal growth factor receptors in human cancer cell lines. 947 10

Since the majority of endometrial carcinomas do not contain any detectable ras mutations, the precise contribution of aberrant Ras function, if any, to endometrial carcinoma development remains to be determined. Since there is considerable evidence that Ras transformation is associated with a decreased requirement for growth factors, we compared the growth response of endometrial carcinoma cells harbouring wild-type (Ishikawa cells) or mutated (HHUA cells) K-ras to epidermal growth factor (EGF). K-ras mutation did not significantly affect the level of the EGF receptor (EGFR) expressed in these carcinoma cells. EGF could stimulate the growth of Ishikawa, but not HHUA cells. Furthermore, EGF caused elevation of Ras-GTP levels in Ishikawa, but not HHUA cells. However, the introduction of mutated, but not normal, K-ras into Ishikawa cells rendered them non-responsive to EGF growth stimulation. Thus, the presence of mutated K-ras alone modulated the growth response of endometrial carcinoma cells to EGF. An inhibitor of the EGFR tyrosine kinase activity could prevent soft agar colony formation of Ishikawa cells, but not HHUA or mutant K-ras(12V)-transfected Ishikawa cells. Taken together, these results suggest that mutated K-ras causes a loss of responsiveness to EGF stimulation and that EGFR function is dispensable for the growth of mutant Ras-positive endometrial carcinoma cells.
 ...
PMID:Oncogenic Ras modulates epidermal growth factor responsiveness in endometrial carcinomas. 971 83

The endogenous factors that underlie the transient induction of the gene encoding spermidine/spermine N1-acetyltransferase (SSAT), the rate-limiting enzyme in cellular polyamine catabolism, in pig uterine endometrium during periimplantation are not known. The present study examined a number of peptide growth factors and regulatory molecules that are present within the uterine environment at early pregnancy, coincident with maximal SSAT gene expression, for their ability to manifest endogenous SSAT gene-inducing activity. Basal SSAT expression in luminal epithelial cells was higher (p < 0. 01) than that for glandular epithelial (GE) or stromal (ST) cells. Recombinant human insulin-like growth factor-I (IGF-I; 50 ng/ml) had no effect on steady-state SSAT mRNA levels, but it increased mitogenesis in all three cell types. In contrast, IGF-I caused a marked induction (p < 0.01) of SSAT mRNA levels in the human endometrial carcinoma cell line Hec-1-A. Uterine explants incubated with interleukin-6, transforming growth factor alpha, epidermal growth factor (each at 1, 10, and 100 ng/ml), retinoic acid and retinol (each at 0.01, 0.1, and 1 microM), and estradiol-17beta (10 nM) had SSAT mRNA levels similar to controls. By contrast, leukemia inhibitory factor (LIF; at 10 and 100 ng/ml) caused a modest, but significant (p < 0.05), increase in SSAT mRNA levels over those of untreated explants. This effect of LIF, however, did not approach the level of induction observed in GE or ST cells after addition of medium conditioned by Day 12 or 17 porcine conceptuses and in endometrial explants supplemented with medium conditioned by Day 21 porcine conceptuses or a continuous cell line (Jag-1) derived from Day 14 porcine trophoblast. We suggest that transient induction of endometrial SSAT gene expression at implantation is mediated by the functional interactions of specific conceptus-derived regulatory factors, distinct from estrogen, with endometrial-derived factor(s) such as LIF. These complex interactions are probably requisite for the transient, yet dramatic, induction of SSAT gene expression and may be critical for successful implantation.
 ...
PMID:Paracrine inducers of uterine endometrial spermidine/spermine N1-acetyltransferase gene expression during early pregnancy in the pig. 978 Mar 34

Lactoferrin (LF) is a member of the transferrin gene family. Its expression in the mouse uterus is regulated by estrogen and epidermal growth factor (EGF). The author et al. cloned the LF gene promoter/enhancer region, and demonstrated that multihormone signaling pathways are involved in modulating LF gene activity. Three short but complex modules, within 400 bp from the transcription initiation site of the mouse LF gene, contain the response elements that are responsible for estrogen, retinoic acid, mitogen, and growth factor stimulation. These elements have been identified and characterized, using reporter constructs transiently transfected into human endometrial carcinoma RL95-2 cells. The author et al. used molecular approaches, such as deletion, insertion, and site-directed mutagenesis, to determine the relationship between the response elements, and to fine-map the crucial nucleotides within them. This article reviews the characterization of the estrogen and EGF response elements of the mouse LF gene promoter.
 ...
PMID:Regulation of lactoferrin gene expression by estrogen and epidermal growth factor: molecular mechanism. 1050 67

The mouse lactoferrin gene promoter includes a CAAT/GT box, GGGCAATAGGGTGGGGCCAGCCC, which functions as the epidermal growth factor response element (EGFRE) in human endometrial carcinoma RL95-2 cells (RL95). A positive clone, EGFREB, of 2575 bp length, was isolated from an expression library of RL95 cells with a multimer of the EGFRE sequence. In this work, we have identified that EGFREB encodes the C-terminus of Kruppel-like factor 5 (KLF5). This mRNA is most abundant in human colon and small intestine. A full-length cDNA clone was isolated from a human colon library using EGFREB as the hybridization probe. The full-length cDNA consists of 3336 bp with a 302 bp 5'-UTR, a 1663 bp 3'-UTR, and a 1371 bp sequence coding for a 457 amino acid polypeptide. Based on its tissue distribution and sequence homology to the mouse IKLF, we renamed this protein IKLF. DNase I footprinting and electrophoresis mobility shift assay confirmed the binding of IKLF to the EGFRE. The human IKLF gene spans >20 kb in length and is organized into four exons, whose intron/exon junctions follow the GT/AG rule. The three zinc fingers are encoded by three exons. Nuclear localization of IKLF was demonstrated by green fluorescence protein (GFP)-tagged IKLF in transfection experiments and western analysis. Overexpression of IKLF in RL95 cells represses the activity of reporter constructs containing the CAAT/GT box of the mouse lactoferrin gene. These findings imply that IKLF is a nuclear transcription factor that binds to the CAAT/GT box, and functions as a modulator of the mouse lacto-ferrin gene promoter activity.
 ...
PMID:Isolation and characterization of a gene encoding human Kruppel-like factor 5 (IKLF): binding to the CAAT/GT box of the mouse lactoferrin gene promoter. 1057 82

Estrogens play a central role in reproductive physiology. The cellular effects of estrogens are mediated by binding to nuclear receptors (ER) which activate transcription of genes involved in cellular growth control. At least two such receptors, designated ERalpha and ERbeta, mediate these effects in conjunction with a number of coactivators. These receptors can directly interact with other members of the steroid receptor superfamily. A complex cross-talk exists between the estrogen-signaling pathways and the downstream signaling events initiated by growth factors, such as epidermal growth factor and insulin-like growth factors. Estrogens are also a causative factor in the pathogenesis of a variety of neoplastic and non-neoplastic diseases, including breast cancer, endometrial cancer, endometriosis, and uterine fibroids, among others. Antiestrogens, such as tamoxifen, are widely used for the treatment of breast cancer. Tamoxifen produces objective tumor shrinkage in advanced breast cancer, reduces the risk of relapse in women treated for invasive breast cancer, and prevents breast cancer in high-risk women. Although, initially developed as an antiestrogen, tamoxifen can also prevent postmenopausal osteoporosis as well as reduce cholesterol, due to its estrogen-agonist effects. Its estrogen-agonist activity, however, can lead to significant side-effects such as endometrial cancer and thromboembolic phenomena. This has led to the concept of "ideal" selective estrogen receptor modulators (SERMs), drugs that would have the desired, tissue selective, estrogen-agonist or -antagonist effects. Raloxifene is a SERM which has the desirable mixed agonist/antagonist effects of tamoxifen but does not cause uterine stimulation. "Pure" antiestrogens may provide very potent estrogen-antagonist drugs, but are likely to be devoid of beneficial effects on bone and lipids. Future drug development efforts should focus on developing superior SERMs that have a greater efficacy against ER-positive tumors and do not cause hot flashes or thromboembolism, and explore combination strategies to simultaneously target hormone-dependent as well as hormone-independent breast cancer.
 ...
PMID:Antiestrogens--tamoxifen, SERMs and beyond. 1066 80


<< Previous 1 2 3 4 5 6 7 Next >>