Gene/Protein Disease Symptom Drug Enzyme Compound
Pivot Concepts:   Target Concepts:
Query: UMLS:C0476089 (endometrial cancer)
 11,379 document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)

Expression of the lactoferrin gene in a variety of tissues is regulated differentially. We have previously demonstrated that the lactoferrin gene is regulated by estrogen and mitogen in mouse uterus. The mouse lactoferrin gene responded to forskolin, cAMP, TPA and EGF stimulation via two adjacent enhancer elements, the CRE and EGFRE and collectively referred to as the Mitogen Response Unit (MRU). We found that CRE is responsible for forskolin, cAMP and TPA whereas EGFRE is for EGF stimulation. We examined the minimal promoter and enhancer elements of the mouse lactoferrin gene that are required for EGF induced transcriptional activation. We found that the CRE and noncanonical TATA box (ATAAA) are the minimal promoter elements for basal activity of the CAT reporter construct, whereas, the EGFRE is needed for an additional activity induced by EGF in transiently transfected human endometrial carcinoma RL95-2 cells (RL95-2). The EGFRE, however, did not function in heterologous promoters (SV 40 and TK). Therefore, EGF-stimulated lactoferrin gene activity is promoter specific in RL95-2 cells. Mutation made at either elements or insertion of extra nucleotides between the two elements, severely affected EGF-stimulated activity. Nuclear protein prepared from RL95-2 cells protected the EGFRE, CRE and noncanonical TATA from DNAase I digestion in a footprinting analysis. Nuclear protein which interacted with the CRE were previously identified as API and CREB. In this study, we isolated a cDNA clone from an RL95-2 expression library that encodes the EGFRE binding protein. Partial sequence of the cDNA clone revealed 100% nucleotide identity with a GC-box binding protein, BTEB2. Protein-protein interaction among the transcription factors could fine-tune the mouse lactoferrin expression in various tissues.
 ...
PMID:Mouse lactoferrin gene. Promoter-specific regulation by EGF and cDNA cloning of the EGF-response-element binding protein. 978 44

The mouse lactoferrin gene promoter includes a CAAT/GT box, GGGCAATAGGGTGGGGCCAGCCC, which functions as the epidermal growth factor response element (EGFRE) in human endometrial carcinoma RL95-2 cells (RL95). A positive clone, EGFREB, of 2575 bp length, was isolated from an expression library of RL95 cells with a multimer of the EGFRE sequence. In this work, we have identified that EGFREB encodes the C-terminus of Kruppel-like factor 5 (KLF5). This mRNA is most abundant in human colon and small intestine. A full-length cDNA clone was isolated from a human colon library using EGFREB as the hybridization probe. The full-length cDNA consists of 3336 bp with a 302 bp 5'-UTR, a 1663 bp 3'-UTR, and a 1371 bp sequence coding for a 457 amino acid polypeptide. Based on its tissue distribution and sequence homology to the mouse IKLF, we renamed this protein IKLF. DNase I footprinting and electrophoresis mobility shift assay confirmed the binding of IKLF to the EGFRE. The human IKLF gene spans >20 kb in length and is organized into four exons, whose intron/exon junctions follow the GT/AG rule. The three zinc fingers are encoded by three exons. Nuclear localization of IKLF was demonstrated by green fluorescence protein (GFP)-tagged IKLF in transfection experiments and western analysis. Overexpression of IKLF in RL95 cells represses the activity of reporter constructs containing the CAAT/GT box of the mouse lactoferrin gene. These findings imply that IKLF is a nuclear transcription factor that binds to the CAAT/GT box, and functions as a modulator of the mouse lacto-ferrin gene promoter activity.
 ...
PMID:Isolation and characterization of a gene encoding human Kruppel-like factor 5 (IKLF): binding to the CAAT/GT box of the mouse lactoferrin gene promoter. 1057 82

The lactoferrin gene in the mouse uterus is a target gene for natural estrogens and xenoestrogens. One of the xenoestrogens is methyoxychlor, an insecticide that displays both estrogenic and antiandrogenic activities. Recently, methyoxychlor was found to stimulate lactoferrin gene expression in the uterus of an estrogen receptor null mouse. The present study is designed to uncover the methoxychlor response region in the mouse lactoferrin gene promoter. A series of different lengths of the mouse lactoferrin gene 5' flanking region were linked to a chloramphenicol acetyltransferase (CAT) reporter construct and transfected into human endometrial carcinoma HEC-1B cells, an estrogen receptor null cell line, in order to examine the methoxychlor response. The transfected cells were treated with methoxychlor or the metabolite of methoxychlor, HPTE, and the CAT reporter activities were measured. Constructs that contain a mouse lactoferrin 5' region longer than 100 bp were activated more than twofold by both methoxychlor and HPTE. The activation of the CAT reporter by the chemicals was dose dependent and reached saturation. Additional deletion mutants within the 100-bp region were tested, and a GC-rich sequence (GC-II) that we have previously characterized as an epidermal growth factor (EGF) response element was identified to be the region for the methoxychlor response. GC-II binds Sp1, Sp3, and IKLF transcription factors, collaborates with the AP1/CREB binding element, and confers the EGF response. Whether the effect of methoxychlor requires the AP1/CREB binding element has yet to be established; however, the present finding provides an alternative signaling pathway for the xenoestrogens.
 ...
PMID:Methoxychlor stimulates the mouse lactoferrin gene promoter through a GC-rich element. 1190 39

Objective: Long noncoding RNA urothelial carcinoma associated 1 (UCA1) was found to facilitate endometrial cancer cell metastasis, and high UCA1 expression predicted endometrial cancer development and patients' worsened outcomes. This research aimed to investigate the cancer promoting role and mechanism of UCA1 in endometrial cancer. Materials and Methods: Around 64 endometrioid adenocarcinoma patients' tissue specimens were analyzed by qRT-PCR. Primary endometrial cancer cell culture was established in vitro. UCA1 overexpression or knockdown was executed by adenoviral transduction. Cell proliferation, apoptosis, colony formation, transwell invasion, and epithelia-to-mesenchymal transition of primary endometrial cancer cells were assessed. Interactions among UCA1, microRNAs (miRNAs), and mRNAs were investigated by luciferase reporter assay and argonaute 2 (AGO2)-RNA immunoprecipitation. Nude mouse xenograft assay was used to explore the role of UCA1 in endometrial cancer in vivo. Results: UCA1 was significantly upregulated in endometrial cancer tissues compared to normal tissues. High expression of UCA1 associated with endometrial cancer progression and patients' decreased survival. Overexpressing UCA1 significantly increased the malignancy of primary endometrial cancer cells in vitro, while UCA1 knockdown showed opposite effect. Kruppel-like factor 5 (KLF5) and relaxin like family peptide receptor 1 (RXFP1) were found as two UCA1 co-expressing genes in endometrial cancer. UCA1 increased the malignancy of endometrial cells partially through KLF5, and it increased the relaxin 2-induced endometrial cancer cell metastasis through RXFP1. UCA1 reduced the si-RNA-induced silencing of KLF5 and RXFP1 genes in endometrial cancer cells. MiR-143-3p and miR-1-3p were found to interact with both UCA1 and KLF5 mRNA. In addition, knockdown of UCA1 suppressed tumor growth in endometrial cancer in vivo. Conclusion: UCA1 might facilitate endometrial cancer development by upregulating KLF5 and RXFP1 gene expression by sponging miR-143-3p and miR-1-3p.
 ...
PMID:Long Noncoding RNA UCA1 Facilitates Endometrial Cancer Development by Regulating KLF5 and RXFP1 Gene Expressions. 3241 93