Gene/Protein
Disease
Symptom
Drug
Enzyme
Compound
Pivot Concepts:
Gene/Protein
Disease
Symptom
Drug
Enzyme
Compound
Target Concepts:
Gene/Protein
Disease
Symptom
Drug
Enzyme
Compound
Query: UMLS:C0376358 (
prostate cancer
)
59,338
document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)
The nuclear and crude nuclear 5 alpha-dihydrotestosterone (DHT) levels were measured in patients with benign prostatic hypertrophy (BPH) and
prostatic cancer
(PC). In the fundamental study using BPH tissues, nuclear DHT levels were not influenced by the treatment for nuclear purification such as DTT, Triton X-100 or
DNase I
. The correlation between DHT levels and androgen receptor contents was found in only the crude nuclear salt extractable fractions (r = 0.748, p less than 0.01). In the relation of DHT levels to
prostatic cancer
patients, crude nuclear salt extractable and salt resistant DHT in both the low grade and in early stage group were significantly higher than those in the high grade and in advanced stage. Moreover, DHT levels in the both crude nuclear salt extractable and salt resistant fractions were below 5 pg/mg protein in all of clinical non-responders to endocrine therapy, and the total crude nuclear DHT, the sum of the crude extractable and salt resistant DHT, was below 10 pg/mg protein in all of the non-responders to endocrine therapy. When the relation between the total crude nuclear DHT level and the clinical course of 34
prostatic cancer
patients followed for over 12 months was studied, the elevated DHT group (over 20 pg/ml protein) responded to endocrine therapy and experienced long-term remissions, but the low DHT group (below 10 pg/ml protein) did not respond to endocrine therapy. Therefore, it is suggested that the total crude nuclear DHT levels were appropriate biochemical indicators for androgen dependency in
prostatic cancer
patients.
...
PMID:[A study on usefulness of the crude nuclear DHT measurement in prostatic cancer patients]. 248 Apr 69
The relationship between androgen receptor concentrations and clinical response to endocrine therapy for prostatic adenocarcinoma was investigated for 13 stage D patients. Both cytoplasmic and nuclear-androgen receptors were quantified. For nuclear androgen receptor, nuclei were isolated and treated with high ionic strength buffer (0.6 M KCl) to yield a KCl-extractable fraction; the nuclei were then treated with
DNase I
to yield nuclear matrices. Electron microscopy confirmed the relative nuclear purity and revealed matrix morphology. An hydroxylapatite binding assay and methyltrienolone (R1881) were used to quantify androgen receptor in cytosol, the KCl-extract and matrix preparations. Following 6 months of hormonal therapy, the clinical status of patients was re-evaluated and the patients were grouped according to disease response. The androgen receptor data obtained prior to therapy were compared for the disease response groups. The mean concentrations of cytoplasmic androgen receptor, KCl-extractable nuclear androgen receptor and nuclear matrix-bound androgen receptor, respectively, in those patients with disease progression or death (no. = 6), were 671 +/- 232, 45 +/- 17 and 119 +/- 34 fmol. per gm. of tissue +/- S.E.M., and for those with disease regression or stabilization (no. = 7), 1427 +/- 435, 193 +/- 53 and 611 +/- 92 fmol. per gm. of tissue +/- S.E.M. While cytoplasmic androgen receptor concentrations were not related to clinical status, both extractable and matrix-bound nuclear androgen receptor concentrations were significantly higher in the group which responded to hormonal therapy. These results suggest that nuclear-extractable and nonextractable androgen receptor concentrations are useful indices for the prediction of hormone-dependence of
prostatic cancer
.
...
PMID:Relationship between concentrations of extractable and matrix-bound nuclear androgen receptor and clinical response to endocrine therapy for prostatic adenocarcinoma. 653 85
L-Plastin is normally a leukocyte-specific actin-binding protein; it is also expressed in the majority of human cancer cell lines that are derived from many types of solid tumors. We have previously reported the isolation of the L-plastin gene promoter, in which we identified several potential steroid receptor-binding sequences. We now obtained evidence that L-plastin gene expression was positively regulated by testosterone in androgen receptor (AR)-positive prostate and breast cancer cells.
DNase I
footprint analysis identified three AR-binding elements (ARE) located in a 545-bp region approximately 1.1 kb upstream from the transcription initiation site. However, each of these three AREs exhibited very little testosterone/AR-responsive enhancer activities toward a test promoter (of the thymidine kinase gene) when tested in MCF-7 breast cancer cells. Their testosterone/AR responsiveness became evident only when two or three of them were combined. In PC-3
prostate cancer
cells, cooperation among L-plastin AREs was still evident although individually they had moderate levels of testosterone/AR responsiveness. Thus, the three L-plastin AREs, despite their imperfect sequences compared with the consensus ARE, could cooperate with each other to become a potent testosterone/AR-responsive unit, which was likely responsible for the inducibility of the L-plastin gene by testosterone.
...
PMID:Upregulation of L-plastin gene by testosterone in breast and prostate cancer cells: identification of three cooperative androgen receptor-binding sequences. 1066 86
Prostate-specific antigen (PSA) is expressed primarily by both normal prostate epithelium and the vast majority of prostate cancers. Increases in serum PSA during endocrine therapy are generally considered as evidence for
prostate cancer
recurrence or progression to androgen independence. The mechanisms by which PSA up-regulation occurs in androgen-refractory
prostate cancer
cells are unknown. In this study, by using LNCaP and its lineage-derived androgen-independent PSA-producing subline, C4-2, we identified two cis-elements within the 5.8-kilobase pair PSA promoter that are essential for the androgen-independent activity of PSA promoter in
prostate cancer
cells. First, a previously reported 440-bp androgen-responsive element enhancer core (AREc) was found to be important for the high basal PSA promoter activity in C4-2 cells. Both mutation analysis and supershift experiments demonstrated that androgen receptor (AR) binds to the AREs within the AREc and activate the basal PSA promoter activity in C4-2 cells under androgen-deprived conditions. Second, a 150-bp pN/H region was demonstrated to be a strong AR-independent positive-regulatory element of the PSA promoter in both LNCaP and C4-2 cells. Through
DNase I
footprinting and linker scan mutagenesis, a 17-bp RI site was identified as the key cis-element within the pN/H region. Data from electrophoretic mobility shift analysis and UV cross-linking experiments further indicated that a 45-kDa (p45) cell-specific transcription factor associates with RI in
prostate cancer
cells and may be responsible for driving the PSA promoter activity independent of androgen and AR. Furthermore, by juxtaposing AREc and pN/H, we produced a chimeric PSA promoter (supra-PSA) that exhibits 2-3-fold higher activity than the wild type PSA promoter in both LNCaP and C4-2 cells.
...
PMID:Regions of prostate-specific antigen (PSA) promoter confer androgen-independent expression of PSA in prostate cancer cells. 1100 69
Human
prostate cancer
cells (DU145) implanted into nude mice are deficient in DNase activity. After administration of a vitamin C/vitamin K(3) combination, both alkaline DNase (
DNase I
) and acid DNase (DNase II) activities were detected in cryosections with a histochemical lead nitrate technique. Alkaline DNase activity appeared 1 hr after vitamin administration, decreased slightly until 2 hr, and disappeared by 8 hr after treatment. Acid DNase activity appeared 2 hr after vitamin administration, reached its highest levels between 4 and 8 hr, and maintained its activity 24 hr after treatment. Methyl green staining indicated that DNase expression was accompanied by a decrease in DNA content of the tumor cells. Microscopic examination of 1-microm sections of the tumors indicated that DNase reactivation and the subsequent degradation of DNA induced multiple forms of tumor cell death, including apoptosis and necrosis. The primary form of vitamin-induced tumor cell death was autoschizis, which is characterized by membrane damage and the progressive loss of cytoplasm through a series of self-excisions. These self-excisions typically continue until the perikaryon consists of an apparently intact nucleus surrounded by a thin rim of cytoplasm that contains damaged organelles.
...
PMID:In vivo reactivation of DNases in implanted human prostate tumors after administration of a vitamin C/K(3) combination. 1111 83
Transcription of the human neutral endopeptidase 24.11 (NEP) gene is androgen regulated in
prostate cancer
cells. Homology search identified a sequence GTCACAaagAGTTCT similar to the ARE consensus sequence GGTACAnnnTGTTCT within the 3'-untranslated region of the NEP mRNA. A double-stranded radiolabelled oligonucleotide containing this NEP-ARE sequence formed a DNA-protein complex with nuclear proteins from LNCaP cells or COS-7 cells co-transfected with an androgen receptor (AR) expression vector, and with full-length AR synthesized by baculovirus in mobility shift assays. Unlabeled NEP-ARE or consensus ARE but not mutated NEP-ARE replaced radiolabelled NEP-ARE. Steroid-dependent enhancement of transcription was assayed by transfecting ptkCAT reporter constructs containing the NEP-ARE into CV-1/AR cells and
prostate cancer
cells (PC-3/AR). Enhancement of chloramphenicol acetyltransferase (CAT) activity was increased four-fold by androgen, seven-fold by dexamethasone and three-fold by progesterone in CV-1/AR cells, and the NEP-ARE bound to glucocorticoid and progesterone receptor in mobility shift assays. We next performed DNase-I footprinting analysis of the NEP promoter and identified a 23 bp sequence GGTGCGGGTCGGAGGGATGCCCA (NEP-ARR) which was protected from
DNase I
cleavage by nuclear extracts from COS-7 cells expressing AR. This sequence was 62.5% homologous to an androgen responsive region (PSA-ARR) identified in the promoter of the prostate specific antigen (PSA) gene. A double-stranded radiolabelled oligonucleotide containing this NEP-ARR sequence formed DNA-protein complex with AR but not GR proteins. Unlabeled NEP-ARR, PSA-ARR and NEP-ARE replaced radiolabelled NEP-ARR. Steroid-dependent enhancement of transcription assays in PC-3/AR cells revealed that the enhancement of CAT activity was increased 2.3-fold by androgen, but not by glucocorticoid or progesterone. In a thymidine kinase promoter, the NEP-ARE and NEP-ARR together stimulated a five-fold increase in promoter activity in PC cells. These data suggest that steroid regulation of the NEP gene involves at least two elements including a typical ARE which binds androgen, progesterone and glucocorticoid receptors, and a unique ARR which only binds androgen receptor.
...
PMID:Identification and characterization of two androgen response regions in the human neutral endopeptidase gene. 1116 97
This work presents direct evidence that the bcl-2 gene is transcriptionally regulated by nuclear factor-kappa B (NF-kappa B) and directly links the TNF-alpha/NF-kappa B signaling pathway with Bcl-2 expression and its pro-survival response in human prostate carcinoma cells.
DNase I
footprinting, gel retardation and supershift analysis identified a NF-kappa B site in the bcl-2 p2 promoter. In the context of a minimal promoter, this bcl-2 p2 site 1 increased transcription 10-fold in the presence of the p50/p65 expression vectors, comparable to the increment observed with the consensus NF-kappa B site, while for the full p2 promoter region transcriptional activity was increased sixfold by over-expression of NF-kappa B, an effect eliminated by mutating the bcl-2 p2 site 1. The expression of Bcl-2 has been linked to the hormone-resistant phenotype of advanced
prostate cancer
. Here we show that an increase in the level of expression of Bcl-2 in the human prostate carcinoma cell line LNCaP observed in response to hormone withdrawal is further augmented by TNF-alpha treatment, and this effect is abated by inhibitors of NF-kappa B. Concomitantly, bcl-2 p2 promoter studies in LNCaP cells show a 40-fold increase in promoter activity after stimulation with TNF-alpha in the absence of hormone.
...
PMID:Transcriptional regulation of bcl-2 by nuclear factor kappa B and its significance in prostate cancer. 1170 64
The transcription factor NF-kappa B regulates gene expression involved in cell growth and survival and has been implicated in progression of hormone-independent breast cancer. By expressing a dominant-active form of mitogen-activated protein kinase kinase kinase 1, by exposure to tumor necrosis factor alpha, or by overexpression of p50/p65, we show that NF-kappa B activates a transcription regulatory element of the prostate-specific antigen (PSA)-encoding gene, a marker for
prostate cancer
development, treatment, and progression. By
DNase I
footprinting, we identified four NF-kappa B binding sites in the PSA core enhancer. We also demonstrate that androgen-independent
prostate cancer
xenografts have higher constitutive NF-kappa B binding activity than their androgen-dependent counterparts. These results suggest a role of NF-kappa B in
prostate cancer
progression.
...
PMID:NF-kappa B activates prostate-specific antigen expression and is upregulated in androgen-independent prostate cancer. 1190 78
Recurring chromosome abnormalities are strongly associated with certain subtypes of leukemia, lymphoma and sarcomas. More recently, their potential involvement in carcinomas, i.e.
prostate cancer
, has been recognized. They are among the most important factors in determining disease prognosis, and in many cases, identification of these chromosome abnormalities is crucial in selecting appropriate treatment protocols. Chromosome translocations are frequently observed in both de novo and therapy-related acute myeloid leukemia (AML) and myelodysplastic syndromes (MDS). The mechanisms that result in such chromosome translocations in leukemia and other cancers are largely unknown. Genomic breakpoints in all the common chromosome translocations in leukemia, including t(4;11), t(9;11), t(8;21), inv(16), t(15;17), t(12;21), t(1;19) and t(9;22), have been cloned. Genomic breakpoints tend to cluster in certain intronic regions of the relevant genes including MLL, AF4, AF9, AML1, ETO, CBFB, MYHI1, PML, RARA, TEL, E2A, PBX1, BCR and ABL. However, whereas the genomic breakpoints in MLL tend to cluster in the 5' portion of the 8.3 kb breakpoint cluster region (BCR) in de novo and adult patients and in the 3' portion in infant leukemia patients and t-AML patients, those in both the AML1 and ETO genes occur in the same clustered regions in both de novo and t-AML patients. These differences may reflect differences in the mechanisms involved in the formation of the translocations. Specific chromatin structural elements, such as in vivo topoisomerase II (topo II) cleavage sites,
DNase I
hypersensitive sites and scaffold attachment regions (SARs) have been mapped in the breakpoint regions of the relevant genes. Strong in vivo topo II cleavage sites and
DNase I
hypersensitive sites often co-localize with each other and also with many of the BCRs in most of these genes, whereas SARs are associated with BCRs in MLL, AF4, AF9, AML1, ETO and ABL, but not in the BCR gene. In addition, the BCRs in MLL, AML1 and ETO have the lowest free energy level for unwinding double strand DNA. Virtually all chromosome translocations in leukemia that have been analyzed to date show no consistent homologous sequences at the breakpoints, whereas a strong non-homologous end joining (NHEJ) repair signature exists at all of these chromosome translocation breakpoint junctions; this includes small deletions and duplications in each breakpoint, and micro-homologies and non-template insertions at genomic junctions of each chromosome translocation. Surprisingly, the size of these deletions and duplications in the same translocation is much larger in de novo leukemia than in therapy-related leukemia. We propose a non-homologous chromosome recombination model as one of the mechanisms that results in chromosome translocations in leukemia. The topo II cleavage sites at open chromatin regions (
DNase I
hypersensitive sites), SARs or the regions with low energy level are vulnerable to certain genotoxic or other agents and become the initial breakage sites, which are followed by an excision end joining repair process.
...
PMID:Chromatin structural elements and chromosomal translocations in leukemia. 1689 85
Genetic mapping studies have identified multiple cancer susceptibility regions at chromosome 8q24, upstream of the MYC oncogene. MYC has been widely presumed as the regulated target gene, but definitive evidence functionally linking these cancer regions with MYC has been difficult to obtain. Here we examined candidate functional variants of a haplotype block at 8q24 encompassing the two independent risk alleles for prostate and breast cancer, rs620861 and rs13281615. We used the mapping of
DNase I
hypersensitive sites as a tool to prioritise regions for further functional analysis. This approach identified rs378854, which is in complete linkage disequilibrium (LD) with rs620861, as a novel functional
prostate cancer
-specific genetic variant. We demonstrate that the risk allele (G) of rs378854 reduces binding of the transcription factor YY1 in vitro. This factor is known to repress global transcription in
prostate cancer
and is a candidate tumour suppressor. Additional experiments showed that the YY1 binding site is occupied in vivo in
prostate cancer
, but not breast cancer cells, consistent with the observed cancer-specific effects of this single nucleotide polymorphism (SNP). Using chromatin conformation capture (3C) experiments, we found that the region surrounding rs378854 interacts with the MYC and PVT1 promoters. Moreover, expression of the PVT1 oncogene in normal prostate tissue increased with the presence of the risk allele of rs378854, while expression of MYC was not affected. In conclusion, we identified a new functional
prostate cancer
risk variant at the 8q24 locus, rs378854 allele G, that reduces binding of the YY1 protein and is associated with increased expression of PVT1 located 0.5 Mb downstream.
...
PMID:A functional variant at a prostate cancer predisposition locus at 8q24 is associated with PVT1 expression. 2181 16
1
2
Next >>