Gene/Protein Disease Symptom Drug Enzyme Compound
Pivot Concepts:   Target Concepts:
Query: UMLS:C0376358 (prostate cancer)
 59,338 document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)

It has been proposed that concentrations of nuclear androgen receptor may be predictive of tumor hormone dependence in cases of advanced human prostatic cancer. We have investigated the ability of this receptor population to reflect patient prognosis during endocrine therapy in 12 cases of stage D disease. KCl-extractable, nuclear matrix-bound and total nuclear androgen receptor concentrations showed a significant positive correlation with duration of patient survival (p less than 0.05) while cytosolic and total cellular androgen receptor concentrations were not significantly correlated with survival. However, use of selected threshold concentrations of receptors revealed that only cytosolic, nuclear KCl-extractable and total cellular receptors could significantly differentiate long-term and short-term survivors. Even given the small number of patients studied, the potential use of this androgen receptor assay as an index of both tumor hormone-dependence and patient prognosis was evident. Therefore, in order to make these androgen receptor assays more applicable, we attempted to simplify the methods for use on readily available tissues. Similar amounts of nuclear androgen binding were observed in crude and purified nuclear pellets, in nuclei treated with DNase and KCl in differing orders or in nuclei from tissue homogenized using glass or Polytron homogenization procedures. More importantly, nuclear androgen receptor concentrations in specimens of prostatic cancer or benign hyperplasia taken by needle biopsy or transurethral resection involving electrocautery did not differ from those of parallel specimens taken by Thompson cold punch. Simplified nuclear androgen receptor assays of needle biopsy or electrocautery specimens are accurate and should prove clinically applicable.
 ...
PMID:Applicability of nuclear androgen receptor quantification to human prostatic adenocarcinoma. 394 59

We have identified a new antiproliferative activity from the conditioned medium of two androgen-independent prostatic cancer cell lines, PC3 and DU-145. This antiproliferative activity selectively inhibited cell proliferation of an androgen-dependent prostate cancer cell line LNCaP in a dose-dependent manner. No antiproliferative activity was observed against mouse fibroblast 3T3, normal human lymphocytes, human leukemic cells, including promyelocyte HL-60 or T cell HUT-78, or human adenocarcinoma cell lines, including prostatic cells JCA-1, ovary NIH:OVCAR-3, cervix C-33A, or breast MDA-MB-231. Cell cycle analysis revealed that the antiproliferative activity did not induce apoptosis in LNCaP cells, but it prevented some G1 LNCaP cells from entering into the S phase of the cell cycle. The antiproliferative activity was sensitive to high temperature (100 degrees C) and to proteinase digestion; however, it was resistant to 56 degrees C, pH 2.0, and reducing agent treatment, as well as to DNase and RNase digestion. The antiproliferative activity was partially purified by gel filtration, ion-exchange chromatography, and SDS-PAGE, with an apparent molecular weight of 50 kD. The antiproliferative activity was not affected by neutralizing antibody against TGF-beta 1,2,3, TNF-alpha, PDGF, EGF, IL-1, IL-2, IL-3, IL-4, or IL-6.
 ...
PMID:Antiproliferative effect of a prostatic cell-derived activity on the human androgen-dependent prostatic carcinoma cell line LNCaP. 859 Mar 22

Recently, we have described a novel gene, DD3, which is one of the most prostate cancer-specific genes described to date (Bussemakers, M. J. G., van Bokhoven, A., Verhaegh, G. W., Smit, F. P., Karthaus, H. F. M., Schalken, J. A., Debruyne, F. M. J., Ru, N., and Isaacs, W. B. (1999) Cancer Res. 59, 5975-5979). The prostate cancer-specific expression of DD3 indicates that the DD3 gene promoter is a promising tool for the treatment of prostate cancer. To identify the promoter elements that are responsible for the prostate cancer-specific expression of DD3, we have isolated and characterized the DD3 promoter. Sequence analysis of the DD3 5'-flanking region was performed and several promoter-human growth hormone reporter constructs were prepared, which were transiently transfected in the DD3-positive cell line LNCaP and several DD3-negative cell lines. Using a 500-base pair DD3 promoter construct, we could detect promoter activity in LNCaP cells, which was not affected by increasing the size of the constructs. Truncated constructs, however, showed an increased transcriptional activity, suggesting the presence of a silencer that negatively regulates the expression of DD3. DNase-I footprint analysis, using nuclear extracts from LNCaP cells, revealed the presence of three DNase-I-protected areas within the DD3 proximal promoter. We show that the high mobility group I(Y) protein binds to one of the DNase-I-protected areas and recruits another, yet unidentified, protein to the DD3 promoter in LNCaP cells.
 ...
PMID:Isolation and characterization of the promoter of the human prostate cancer-specific DD3 gene. 1098 8

Human prostate cancer cells (DU145) implanted into nude mice are deficient in DNase activity. After administration of a vitamin C/vitamin K(3) combination, both alkaline DNase (DNase I) and acid DNase (DNase II) activities were detected in cryosections with a histochemical lead nitrate technique. Alkaline DNase activity appeared 1 hr after vitamin administration, decreased slightly until 2 hr, and disappeared by 8 hr after treatment. Acid DNase activity appeared 2 hr after vitamin administration, reached its highest levels between 4 and 8 hr, and maintained its activity 24 hr after treatment. Methyl green staining indicated that DNase expression was accompanied by a decrease in DNA content of the tumor cells. Microscopic examination of 1-microm sections of the tumors indicated that DNase reactivation and the subsequent degradation of DNA induced multiple forms of tumor cell death, including apoptosis and necrosis. The primary form of vitamin-induced tumor cell death was autoschizis, which is characterized by membrane damage and the progressive loss of cytoplasm through a series of self-excisions. These self-excisions typically continue until the perikaryon consists of an apparently intact nucleus surrounded by a thin rim of cytoplasm that contains damaged organelles.
 ...
PMID:In vivo reactivation of DNases in implanted human prostate tumors after administration of a vitamin C/K(3) combination. 1111 83

Transcription of the human neutral endopeptidase 24.11 (NEP) gene is androgen regulated in prostate cancer cells. Homology search identified a sequence GTCACAaagAGTTCT similar to the ARE consensus sequence GGTACAnnnTGTTCT within the 3'-untranslated region of the NEP mRNA. A double-stranded radiolabelled oligonucleotide containing this NEP-ARE sequence formed a DNA-protein complex with nuclear proteins from LNCaP cells or COS-7 cells co-transfected with an androgen receptor (AR) expression vector, and with full-length AR synthesized by baculovirus in mobility shift assays. Unlabeled NEP-ARE or consensus ARE but not mutated NEP-ARE replaced radiolabelled NEP-ARE. Steroid-dependent enhancement of transcription was assayed by transfecting ptkCAT reporter constructs containing the NEP-ARE into CV-1/AR cells and prostate cancer cells (PC-3/AR). Enhancement of chloramphenicol acetyltransferase (CAT) activity was increased four-fold by androgen, seven-fold by dexamethasone and three-fold by progesterone in CV-1/AR cells, and the NEP-ARE bound to glucocorticoid and progesterone receptor in mobility shift assays. We next performed DNase-I footprinting analysis of the NEP promoter and identified a 23 bp sequence GGTGCGGGTCGGAGGGATGCCCA (NEP-ARR) which was protected from DNase I cleavage by nuclear extracts from COS-7 cells expressing AR. This sequence was 62.5% homologous to an androgen responsive region (PSA-ARR) identified in the promoter of the prostate specific antigen (PSA) gene. A double-stranded radiolabelled oligonucleotide containing this NEP-ARR sequence formed DNA-protein complex with AR but not GR proteins. Unlabeled NEP-ARR, PSA-ARR and NEP-ARE replaced radiolabelled NEP-ARR. Steroid-dependent enhancement of transcription assays in PC-3/AR cells revealed that the enhancement of CAT activity was increased 2.3-fold by androgen, but not by glucocorticoid or progesterone. In a thymidine kinase promoter, the NEP-ARE and NEP-ARR together stimulated a five-fold increase in promoter activity in PC cells. These data suggest that steroid regulation of the NEP gene involves at least two elements including a typical ARE which binds androgen, progesterone and glucocorticoid receptors, and a unique ARR which only binds androgen receptor.
 ...
PMID:Identification and characterization of two androgen response regions in the human neutral endopeptidase gene. 1116 97

Previously, we reported the evaluation of several polyplex-based gene delivery systems with respect to their effectiveness, toxicity, and cell type dependence in vitro. One system, P123-g-PEI(2K), a cationic graft block copolymer, is of particular interest as it has been demonstrated to successfully deliver genetic material to murine liver following systemic delivery [Nguyen, H. K., Lemieux, P., Vinogradov, S. V., Gebhart, C. L., Guerin, N., Paradis, G., Bronich, T. K., Alakhov, V. Y., and Kabanov, A. V. (2000) Evaluation of Polyether-Polyethyleneimine Graft Copolymers as Gene Transfer Agents. Gene Ther. 7, 126-138 (1)]. The P123-g-PEI(2K) system requires nonmodified Pluronic P123 as an excipient to stabilize the dispersion. The purpose of the current work was to more closely characterize this system, to assess the role of each component of the system to the overall transfection process. We evaluated particle size, stability, and resistance to nuclease degradation. In addition, cellular uptake and localization of plasmid, as well as transgene expression, were evaluated following in vitro transfection of prostate cancer cells (PC-3) with various individual components of the system. Nonmodified Pluronic alone did not significantly enhance DNA uptake, transgene expression, or DNase protection. Therefore, we conclude that nonmodified Pluronic acted primarily by optimizing the size of the polyplex. Furthermore, though this system displays several characteristics thought desirable of a nonviral gene delivery system, these studies did discriminate a potential limitation of this system for in vivo applications, namely, the insufficient level of protection of plasmid DNA from nuclease degradation. This may limit the effective dose delivered, as well as limiting the effective circulation time. These studies provide vital information that will guide modification of this system to enhance the current in vivo profile.
 ...
PMID:Design and formulation of polyplexes based on pluronic-polyethyleneimine conjugates for gene transfer. 1223 74

The prostate-specific homeodomain protein NKX3.1 is a tumor suppressor that is commonly down-regulated in human prostate cancer. Using an NKX3.1 affinity column, we isolated topoisomerase I (Topo I) from a PC-3 prostate cancer cell extract. Topo I is a class 1B DNA-resolving enzyme that is ubiquitously expressed in higher organisms and many prokaryotes. NKX3.1 interacts with Topo I to enhance formation of the Topo I-DNA complex and to increase Topo I cleavage of DNA. The two proteins interacted in affinity pull-down experiments in the presence of either DNase or RNase. The NKX3.1 homeodomain was essential, but not sufficient, for the interaction with Topo I. NKX3.1 binding to Topo I occurred independently of the Topo I NH2-terminal domain. The binding of equimolar amounts of Topo I to NKX3.1 caused displacement of NKX3.1 from its cognate DNA recognition sequence. Topo I activity in prostates of Nkx3.1+/- and Nkx3.1-/- mice was reduced compared with wild-type mice, whereas Topo I activity in livers, where no NKX3.1 is expressed, was independent of Nkx3.1 genotype. Endogenous Topo I and NKX3.1 could be coimmunoprecipitated from LNCaP cells, where NKX3.1 and Topo I were found to colocalize in the nucleus and comigrate within the nucleus in response to either gamma-irradiation or mitomycin C exposure, two DNA-damaging agents. This is the first report that a homeodomain protein can modify the activity of Topo I and may have implications for organ-specific DNA replication, transcription, or DNA repair.
 ...
PMID:NKX3.1 homeodomain protein binds to topoisomerase I and enhances its activity. 1723 52

The promoter of the murine probasin (PB) gene exhibits strong androgen receptor (AR)-specific and tissue-specific regulation and is considered a promising candidate for gene therapy treatment of advanced prostate cancer. To characterize the determinants of chromatin specificity of the PB promoter with the AR we initially investigated the in vitro interactions of recombinant AR DNA binding domain (AR-DBD) with reconstituted nucleosomes incorporating the proximal PB promoter (nucleotides -268 to -76). We demonstrate that a DNA fragment of this promoter region exhibits strong nucleosome positioning. The phased DNA sequence protected by the histone octamer includes four androgen receptor response elements (AREs) which are arranged as two sets of class I and class II sites spaced approximately 90bp apart. Class I AREs form classical contacts with the AR, whereas class II AREs contain atypical binding sequences and have been shown to stabilize AR binding to adjacent class I sites, resulting in synergistic transcriptional activation and increased hormone sensitivity. We used DNase 1 footprinting and electrophoretic mobility shift assays (EMSA) to show that the AR-DBD binds to its cognate sequences independently of their nucleosomal organization. In addition, we show that the ability of the AR-DBD to interact with the nucleosomal PB promoter is not affected by histone acetylation. Thus the AR-DBD is able to bind to its cognate sequences within the PB promoter in a way that is indifferent to the presence or absence of histones and nucleosomal structure.
 ...
PMID:Probasin promoter assembles into a strongly positioned nucleosome that permits androgen receptor binding. 1731 77

Xenotropic murine leukemia virus-related virus (XMRV) is a new human gammaretrovirus identified in prostate cancer tissue from patients homozygous for a reduced-activity variant of the antiviral enzyme RNase L. Neither a casual relationship between XMRV infection and prostate cancer nor a mechanism of tumorigenesis has been established. To determine the integration site preferences of XMRV and the potential risk of proviral insertional mutagenesis, we carried out a genome-wide analysis of viral integration sites in the prostate cell line DU145 after an acute XMRV infection and compared the integration site pattern of XMRV with those found for murine leukemia virus and two human retroviruses, human immunodeficiency virus type 1 and human T-cell leukemia virus type 1. Among all retroviruses analyzed, XMRV has the strongest preference for transcription start sites, CpG islands, DNase-hypersensitive sites, and gene-dense regions; all are features frequently associated with structurally open transcription regulatory regions of a chromosome. Analyses of XMRV integration sites in tissues from prostate cancer patients found a similar preference for the aforementioned chromosomal features. Additionally, XMRV integration sites in cancer tissues were associated with cancer breakpoints, common fragile sites, microRNA, and cancer-related genes, suggesting a selection process that favors certain chromosomal integration sites. In both acutely infected cells and cancer tissues, no common integration site was detected within or near proto-oncogenes or tumor suppressor genes. These results are consistent with a model in which XMRV may contribute to tumorigenicity via a paracrine mechanism.
 ...
PMID:Integration site preference of xenotropic murine leukemia virus-related virus, a new human retrovirus associated with prostate cancer. 1868 13

The DNase activity and circulating DNA (cirDNA) concentration in blood plasma of healthy donors, patients with chronic prostatitis, and patients with prostate tumors were analyzed. The concentration of the cirDNA from plasma was determined by PicoGreen fluorescent assay. DNase activity in blood was measured using the immunoassay based on the cleavage of a hapten-labeled 974-bp DNA substrate. The mean cirDNA concentration in the plasma of healthy donors was low (21 +/- 4 ng/mL total blood) and was accompanied by high DNase activity (0.17 +/- 0.04 U/mL blood). The mean cirDNA concentration was 90 ng/mL blood (10-234 ng/mL) in the patients with nonmalignant prostate tumors and 115 ng/mL blood (13-339 ng/mL) in those with prostate cancer. The mean DNase activity in blood plasma of the patients with prostate tumors was 0.06 U/mL blood (0-0.12 U/mL). The results obtained demonstrate that increased concentrations of cirDNA in blood of the patients with prostate tumors is accompanied by a decreased DNase activity, confirming our previous data that a low DNase activity in blood plasma of cancer patients is one reason for a high cirDNA concentration.
 ...
PMID:Deoxyribonuclease activity and circulating DNA concentration in blood plasma of patients with prostate tumors. 1883 50


1 2 Next >>