Gene/Protein Disease Symptom Drug Enzyme Compound
Pivot Concepts:   Target Concepts:
Query: UMLS:C0376358 (prostate cancer)
 59,338 document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)

Human endopeptidase 24.11 (EP) occurs in greatest abundance on terminally differentiated prostate cells; thus, loss of EP could mark dedifferentiation of prostate epithelium. To identify laboratory models that would permit continuous work on the biochemistry and hormonal regulation of EP, we examined the well-differentiated LNCaP and poorly differentiated PPC-1 human prostate cancer cell lines. Ultrastructural analysis revealed that LNCaP secretes electron-dense material that resembles the particulate matter of seminal plasma, which is associated with endopeptidase activity. LNCaP medium contained EP activity while PPC-1 medium did not. Whether the apparent deletion of EP from the PPC-1 cell line is characteristic of poorly differentiated prostate adenocarcinoma is not yet clear. However, it may be relevant to the carcinogenic process that EP can limit growth of lung small carcinomas by inactivating cell growth-promoting bombesin-like peptides. Because bombesin has been identified in aggressive human prostate cancers, loss of EP in PPC-1 could represent a necessary step in transformation to aggressive phenotype. The combination of LNCaP and PPC-1, which offers well-differentiated and poorly differentiated cancer phenotypes, appears well suited to studying the relevance of EP in prostate cancer biology.
 ...
PMID:Endopeptidase 24.11 activity in the human prostate cancer cell lines LNCaP and PPC-1. 914 77

The formation and processing of neurotensin (NT) by three prostate cancer cell lines was investigated. Neurotensin (NT) immunoreactivity was detected in conditioned media and extracts of LNCaP cells. Using HPLC techniques, the immunoreactivity extracted from LNCaP cells coeluted with synthetic NT standard. Metalloendopeptidase 3.4.24.15 activity was detected in PC-3, DU-145 and LNCaP cells, whereas high levels of neutral endopeptidase 3.4.24.1 1 activity was detected only in LNCaP cells. NT was relatively stable when incubated with PC-3 or D-145 cells but was rapidly degraded by LNCaP cells to NT1-11 and NT1-10. Phosphoramidon inhibited the metabolism of NT by LNCaP cells. These data suggest that NT is present in and metabolized by LNCaP cellular enzymes.
 ...
PMID:Neurotensin is metabolized by endogenous proteases in prostate cancer cell lines. 949 57

Prostate-specific antigen (PSA), a serine endoprotease with chymotrypsin-like substrate specificity, is a marker used widely for detection of prostate cancer and other prostate diseases, catalyzing hydrolysis of the gel-forming proteins semenogelins I and II, which are synthesized and secreted by the seminal vesicle. In this study we report the use of two single-position minilibraries and RP-HPLC selection to optimize a hexapeptide substrate for PSA, spanning substrate positions P3 to P3'. PSA has been shown previously to prefer tyrosine in position P1 [Denmeade et al. (1997) Cancer Research, 57, 4924-4930]. Here we demonstrate preference for serine in position P1' and strong preference for phenylalanine in position P2. Based on these results we have designed and demonstrated the utility of the optimized fluorogenic PSA substrate 7-methoxy-coumarin-4-acetylGlnPheTyrSerSerAsnLys(epsilon-2,4-dinit rophenyl)amide, 1, which permits continuous monitoring of PSA endopeptidase activity at high sensitivity.
 ...
PMID:Design of synthetic hexapeptide substrates for prostate-specific antigen using single-position minilibraries. 1056 10

Androgen-mediated growth repression of androgen-independent prostate cancer (AIPC) cells has been reported in androgen-independent PC-3 cells overexpressing the androgen receptor, and in androgen-independent derivatives of LNCaP cells that develop following prolonged culture in androgen-free media. Using two models of AIPC, PC3/AR cells and LNCaP-OM1 cells, a subclone of LNCaP cells derived by prolonged culturing in charcoal-stripped media, we investigated whether expression of neutral endopeptidase 24.11 (NEP), a cell-surface peptidase that cleaves and inactivates neuropeptides implicated in the growth of AIPC, is induced by androgen, and whether NEP contributes to the observed androgen-mediated growth repression. These cell lines each express high levels of androgen receptor. Culturing in dihyrotestosterone (DHT) resulted in a 30-56% (PC3) and 35-43% (LNCaP-OM1) decrease in cell number over 7 days concomitant with a significant increase in NEP enzyme specific activity. Northern analysis detected an increase in NEP transcripts following DHT treatment in PC3/AR cells. The addition of the NEP enzyme inhibitor phosphoramidon to PC3 and LNCaP-OM1 or the NEP competitive inhibitor CGS 24592 to LNCaP-OM1 blocked the increase in NEP enzyme activity and reversed the DHT-induced growth inhibition. Neither phosphoramidon or CGS 24592 alone inhibited cell growth. Furthermore, the reversal of growth inhibition in LNCaPOM1 cells was dose dependent on the concentration of CGS 24592. These data indicate that androgen-induced growth repression of AIPC cells PC3 and LNCaP-OM1 results in part from androgen-induced expression of NEP in these cells.
 ...
PMID:Androgen-induced growth inhibition of androgen receptor expressing androgen-independent prostate cancer cells is mediated by increased levels of neutral endopeptidase. 1080 79

Neutral endopeptidase 24.11 (NEP, CD10) is a cell-surface enzyme expressed by prostatic epithelial cells that cleaves and inactivates neuropeptides implicated in the growth of androgen-independent prostate cancer (PC). NEP substrates such as bombesin and endothelin-1 induce cell migration. We investigated the mechanisms of NEP regulation of cell migration in PC cells, including regulation of phosphorylation on tyrosine of focal adhesion kinase (FAK). Western analyses and cell migration assays revealed an inverse correlation between NEP expression and the levels of FAK phosphorylation and cell migration in PC cell lines. Constitutively expressed NEP, recombinant NEP, and induced NEP expression using a tetracycline-repressive expression system inhibited bombesin- and endothelin-1-stimulated FAK phosphorylation and cell migration. This results from NEP-induced inhibition of neuropeptide-stimulated association of FAK with cSrc protein. Expression of a mutated catalytically inactive NEP protein also resulted in partial inhibition of FAK phosphorylation and cell migration. Coimmunoprecipitation experiments show that NEP associates with tyrosine-phosphorylated Lyn kinase, which then binds the p85 subunit of phosphatidylinositol 3-kinase (PI3-K) resulting in an NEP-Lyn-PI3-K protein complex. This complex competitively blocks FAK-PI3-K interaction, suggesting that NEP protein inhibits cell migration via a protein-protein interaction independent of its catalytic function. These experiments demonstrate that NEP can inhibit FAK phosphorylation on tyrosine and PC cell migration through multiple pathways and suggest that cell migration which contributes to invasion and metastases in PC cells can be regulated by NEP.
 ...
PMID:Neutral endopeptidase inhibits prostate cancer cell migration by blocking focal adhesion kinase signaling. 1110 93

Phorbol esters induce apoptosis in androgen-sensitive LNCaP cells, which express neutral endopeptidase (NEP), but not in androgen-independent prostate cancer (PC) cells, which lack NEP expression. We investigated the role of NEP in PC cell susceptibility to 12-O-tetradecanoylphorbol-13-acetate (TPA). Western analysis showed that expression of NEP and protein kinase Cdelta (PKCdelta) correlated with PC cell sensitivity to TPA-induced growth arrest and apoptosis in LNCaP cells and in TSU-Prl cells expressing an inducible wild-type NEP protein. Inhibition of NEP enzyme activity using the specific NEP inhibitor CGS24592, or inhibition of PKCdelta using Rottlerin at concentrations that inhibit PKCdelta but not PKCalpha, significantly inhibited TPA-induced growth inhibition and cell death. Furthermore, pulse-chase experiments showed PKCdelta is stabilized in LNCaP cells and in TSU-Pr1 cells overexpressing wild-type NEP compared with PC cells lacking NEP expression. This results from NEP inactivation of its neuropeptide substrates (bombesin and endothelin-1), which in the absence of NEP stimulate cSrc kinase activity and induce rapid degradation of PKCdelta protein. These results indicate that expression of enzymatically active NEP by PC cells is necessary for TPA-induced apoptosis, and that NEP inhibits neuropeptide-induced, cSrc-mediated PKCdelta degradation.
 ...
PMID:Neutral endopeptidase promotes phorbol ester-induced apoptosis in prostate cancer cells by inhibiting neuropeptide-induced protein kinase C delta degradation. 1111 39

Transcription of the human neutral endopeptidase 24.11 (NEP) gene is androgen regulated in prostate cancer cells. Homology search identified a sequence GTCACAaagAGTTCT similar to the ARE consensus sequence GGTACAnnnTGTTCT within the 3'-untranslated region of the NEP mRNA. A double-stranded radiolabelled oligonucleotide containing this NEP-ARE sequence formed a DNA-protein complex with nuclear proteins from LNCaP cells or COS-7 cells co-transfected with an androgen receptor (AR) expression vector, and with full-length AR synthesized by baculovirus in mobility shift assays. Unlabeled NEP-ARE or consensus ARE but not mutated NEP-ARE replaced radiolabelled NEP-ARE. Steroid-dependent enhancement of transcription was assayed by transfecting ptkCAT reporter constructs containing the NEP-ARE into CV-1/AR cells and prostate cancer cells (PC-3/AR). Enhancement of chloramphenicol acetyltransferase (CAT) activity was increased four-fold by androgen, seven-fold by dexamethasone and three-fold by progesterone in CV-1/AR cells, and the NEP-ARE bound to glucocorticoid and progesterone receptor in mobility shift assays. We next performed DNase-I footprinting analysis of the NEP promoter and identified a 23 bp sequence GGTGCGGGTCGGAGGGATGCCCA (NEP-ARR) which was protected from DNase I cleavage by nuclear extracts from COS-7 cells expressing AR. This sequence was 62.5% homologous to an androgen responsive region (PSA-ARR) identified in the promoter of the prostate specific antigen (PSA) gene. A double-stranded radiolabelled oligonucleotide containing this NEP-ARR sequence formed DNA-protein complex with AR but not GR proteins. Unlabeled NEP-ARR, PSA-ARR and NEP-ARE replaced radiolabelled NEP-ARR. Steroid-dependent enhancement of transcription assays in PC-3/AR cells revealed that the enhancement of CAT activity was increased 2.3-fold by androgen, but not by glucocorticoid or progesterone. In a thymidine kinase promoter, the NEP-ARE and NEP-ARR together stimulated a five-fold increase in promoter activity in PC cells. These data suggest that steroid regulation of the NEP gene involves at least two elements including a typical ARE which binds androgen, progesterone and glucocorticoid receptors, and a unique ARR which only binds androgen receptor.
 ...
PMID:Identification and characterization of two androgen response regions in the human neutral endopeptidase gene. 1116 97

Neutral endopeptidase-24.11 (neprilysin; NEP/CD10) is a cell surface metallopeptidase expressed by prostatic epithelial cells that degrades various bioactive peptides including endothelin. Endothelin-converting enzyme (ECE), the key enzyme of endothelin biosynthesis, catalyses the final processing step in the pathway. Neuropeptide substrates of NEP, including endothelin, have been implicated in the growth of androgen-independent prostate cancer. We have surveyed the expression of NEP and ECE in a range of prostate cancer cell lines. Western analysis reveals that ECE-1 is expressed abundantly in all the malignant cell lines tested, except for LNCaP. In contrast, LNCaP cells express high levels of NEP, while NEP was not detected in PC-3, DU145 and other metastatic cell lines that were tested. Of the normal immortalized prostate epithelial cell lines, PNT1a shows equivalent amounts of NEP and ECE. PNT2-C2 shows poor NEP expression but an abundance of ECE. P4E6, by comparison, has low levels of both ECE and NEP. These differences in expression may render these cell lines useful in experimental models for future study. Benign prostatic hyperplasia primary epithelial cells express much higher levels of NEP than malignant primary epithelial cells, but neither show ECE expression. On the other hand, surrounding stromal cell populations have detectable ECE levels. An absence of ECE in malignant and benign prostatic hyperplasia cells of primary epithelial origin suggests an important role for stromal interaction and paracrine production of ECE within the host. The upregulation of ECE expression in metastatic cells in culture may be indicative of its role in metastatic progression. A differential profile of ECE and NEP could contribute to an abundance of mitogenic peptides aiding the progression of androgen-independent prostate cancer.
 ...
PMID:Differential expression of neutral endopeptidase-24.11 (neprilysin) and endothelin-converting enzyme in human prostate cancer cell lines. 1219 12

There is increasing evidence that neuropeptides, including bombesin, may influence growth, angiogenesis, invasiveness, and metastasis in prostate cancer. One of the molecules tightly involved in the regulation of neuropeptide activity is the integral membrane glycoprotein CD10, or neutral endopeptidase 24.11. The pattern of CD10 expression in hyperplastic and neoplastic conditions of the prostate gland has not been previously described. Immunohistochemical staining for CD10 and high-molecular-weight cytokeratin was performed on 92 cases of paraffin-embedded tissue from needle-core biopsy specimens and prostatectomy specimens. Normal and hyperplastic acini showed strong and distinct membrane (apical and intercellular) and cytoplasmic CD10 expression in basal and secretory cells. In contrast, no intercellular membrane or cytoplasmic staining of secretory cells was seen in any cases of adenocarcinoma with Gleason patterns 2 or 3. A subset of high-Gleason grade adenocarcinoma (patterns 4 and 5) displayed CD10 expression in the secretory cells; those cases shared a distinct morphological pattern. Prostatic intraepithelial neoplasia (PIN) showed consistent absence of intercellular membrane and cytoplasmic CD10 expression in the secretory cells, with preserved expression in basal cells. Interestingly, the basal cells in basal cell hyperplasia lacked CD10 expression, and no expression was noted in the secretory cells in all cases examined. Atrophic acini and those associated with acute and chronic inflammation retained CD10 expression. In conclusion, a consistent differential pattern of CD10 expression was seen in basal cell hyperplasia, PIN, and adenocarcinoma, suggesting a role for CD10 in the pathobiology of the prostate gland.
 ...
PMID:The pattern of CD10 expression in selected pathologic entities of the prostate gland. 1279 18

NEP (Neutral endopeptidase 24.11) is a cell surface enzyme that hydrolyzes bioactive neuropeptides implicated in the transition from androgen-dependent prostate cancer (PC) to androgen-independent PC. We report the cloning and sequence analyses of NEP cDNAs from human androgen-responsive LNCaP PC cells and prostatic stromal cells. To investigate the functional role of a nuclear localization sequence (NLS) detected within the N-terminus and of an endoplasmic reticulum retention signal within the C-terminus, NEP-GFP expression vectors were constructed containing the whole NEP gene, fragments encoding the N-terminus/C-terminus of the protein (5(')NEP-GFP/3(')NEP-GFP), and 5(')NEP-GFP constructs lacking the NLS. 3(')NEP-GFP transfected cells showed plasma membrane/cytoplasmic fluorescence whereas the 5(')NEP-GFP fusion protein was also detected in the nucleus. The omission of the NLS resulted in no reduction in nuclear and an increase in cytoplasmic staining. The results suggest that the analyzed structural motifs determine the subcellular distribution of NEP in epithelial LNCaP PC cells and stromal prostatic cells and therefore could be responsible for the altered cellular localization of NEP observed in PC.
 ...
PMID:Independent signals determine the subcellular localization of NEP in prostate cancer cells. 1455 Feb 92


1 2 3 4 Next >>