Gene/Protein
Disease
Symptom
Drug
Enzyme
Compound
Pivot Concepts:
Gene/Protein
Disease
Symptom
Drug
Enzyme
Compound
Target Concepts:
Gene/Protein
Disease
Symptom
Drug
Enzyme
Compound
Query: UMLS:C0376358 (
prostate cancer
)
59,338
document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)
The crystal structures of the human androgen receptor (hAR) and human
progesterone receptor
ligand-binding domains in complex with the same ligand metribolone (R1881) have been determined. Both three-dimensional structures show the typical nuclear receptor fold. The change of two residues in the ligand-binding pocket between the human
progesterone receptor
and hAR is most likely the source for the specificity of R1881 to the hAR. The structural implications of the 14 known mutations in the ligand-binding pocket of the hAR ligand-binding domains associated with either
prostate cancer
or the partial or complete androgen receptor insensitivity syndrome were analyzed. The effects of most of these mutants could be explained on the basis of the crystal structure.
...
PMID:Structural evidence for ligand specificity in the binding domain of the human androgen receptor. Implications for pathogenic gene mutations. 1084 43
The aim of the current study is to demonstrate normal and malignant prostatic epithelial cells (PrECs) as targets for receptor-mediated estrogenic and antiestrogenic action. Using an improved protocol, we have successfully isolated and maintained highly enriched populations of normal PrECs from ultrasound-guided peripheral zone biopsies, individually determined to be morphologically normal. Semiquantitative reverse transcription-PCR analyses were used to determine whether transcripts of estrogen receptor (ER)-alpha and those of ER-beta were expressed in our normal PrEC primary cultures, in a commercially available PrEC preparation (PrEC; Clontech), in an immortalized PrEC line established from a benign prostatic hyperplasia specimen (BPH-1), and in three
prostatic cancer
cell lines (LNCaP, PC-3, and DU145). Expression levels of ER-alpha and ER-beta transcripts were related to those of two estrogen-responsive genes [
progesterone receptor
(PR) and pS2], at the message levels, to gain insights into the functionality of the ER subtypes in PrECs. Interestingly, only transcripts of ER-beta, but not those of ER-alpha, were found in our primary cultures of normal PrECs, along with both PR and pS2 mRNA. These data strongly suggest that estrogen action was signaled exclusively via ER-beta in normal human PrECs. In contrast, PrEC (Clontech) and BPH-1 cells expressed both ER-alpha and ER-beta transcripts and no PR nor pS2 mRNA in PrEC and only a minimal level of PR mRNA in BPH-1. Among the three
prostate cancer
cell lines, LNCaP expressed ER-beta mRNA along with transcripts of PR and pS2, DU145 expressed messages of ER-beta and PR, and PC-3 cells exhibited ER-alpha, ER-beta, and pS2 mRNA. Thus, unlike normal PrECs, expression patterns of these genes in malignant PrECs are more variable. Treatment of
prostate cancer
cells with demethylation agents effectively reactivated the expression of ER-alpha mRNA in LNCaP and DU145 and that of pS2 message in DU145. These findings provide experimental evidence that ER-alpha gene silencing in
prostate cancer
cells, and perhaps also in normal PrECs, are caused by DNA hypermethylation. To evaluate the potential of using antiestrogens as
prostate cancer
therapies, we have assessed the growth-inhibitory action of estrogens (estradiol and diethylstilbestrol) and antiestrogens (4-hydroxy-tamoxifen and ICI-182,780) on PC-3 and DU-145 cells. In PC-3 cells, which express both ER subtypes, estrogens as well as antiestrogens are effective inhibitors. In contrast, in DU145 cells, which express only ER-beta, antiestrogens, but not estrogens, are growth inhibitors. By comparison, ICI 182,780 is the more effective cell growth inhibitor. Importantly, the ICI 182,780-induced antiproliferative effects were reversed by cotreatment of DU145 cells with an ER-beta antisense oligonucleotide, hence lending additional support to a central role played by ER-beta in mediating growth-inhibitory action of antiestrogens.
...
PMID:Expression of estrogen receptor (ER)-alpha and ER-beta in normal and malignant prostatic epithelial cells: regulation by methylation and involvement in growth regulation. 1086 8
Transcription of the human neutral endopeptidase 24.11 (NEP) gene is androgen regulated in
prostate cancer
cells. Homology search identified a sequence GTCACAaagAGTTCT similar to the ARE consensus sequence GGTACAnnnTGTTCT within the 3'-untranslated region of the NEP mRNA. A double-stranded radiolabelled oligonucleotide containing this NEP-ARE sequence formed a DNA-protein complex with nuclear proteins from LNCaP cells or COS-7 cells co-transfected with an androgen receptor (AR) expression vector, and with full-length AR synthesized by baculovirus in mobility shift assays. Unlabeled NEP-ARE or consensus ARE but not mutated NEP-ARE replaced radiolabelled NEP-ARE. Steroid-dependent enhancement of transcription was assayed by transfecting ptkCAT reporter constructs containing the NEP-ARE into CV-1/AR cells and
prostate cancer
cells (PC-3/AR). Enhancement of chloramphenicol acetyltransferase (CAT) activity was increased four-fold by androgen, seven-fold by dexamethasone and three-fold by progesterone in CV-1/AR cells, and the NEP-ARE bound to glucocorticoid and
progesterone receptor
in mobility shift assays. We next performed DNase-I footprinting analysis of the NEP promoter and identified a 23 bp sequence GGTGCGGGTCGGAGGGATGCCCA (NEP-ARR) which was protected from DNase I cleavage by nuclear extracts from COS-7 cells expressing AR. This sequence was 62.5% homologous to an androgen responsive region (PSA-ARR) identified in the promoter of the prostate specific antigen (PSA) gene. A double-stranded radiolabelled oligonucleotide containing this NEP-ARR sequence formed DNA-protein complex with AR but not GR proteins. Unlabeled NEP-ARR, PSA-ARR and NEP-ARE replaced radiolabelled NEP-ARR. Steroid-dependent enhancement of transcription assays in PC-3/AR cells revealed that the enhancement of CAT activity was increased 2.3-fold by androgen, but not by glucocorticoid or progesterone. In a thymidine kinase promoter, the NEP-ARE and NEP-ARR together stimulated a five-fold increase in promoter activity in PC cells. These data suggest that steroid regulation of the NEP gene involves at least two elements including a typical ARE which binds androgen, progesterone and glucocorticoid receptors, and a unique ARR which only binds androgen receptor.
...
PMID:Identification and characterization of two androgen response regions in the human neutral endopeptidase gene. 1116 97
Steroid hormones can have profound effects on prostate tumor development making it important to define steroid receptor expression in prostate tissues. For this purpose, androgen receptor (AR) and estrogen receptor (ER alpha and ER beta) expression was quantified in 12 clinically localized and 11 hormone-refractory sporadic prostate tumors, using real-time quantitative reverse transcription-PCR assays. To gain more insight into hormone-responsiveness, estrogen-regulated
progesterone receptor
(
PGR
) and androgen-regulated prostatic acid phosphatase (PAP) mRNA levels were also quantified. There is a decrease in expression of ER beta in both clinically localized and hormone-refractory tumors relative to normal prostate tissues. Moreover, hormone-refractory tumors display a decreased expression of ER alpha and an increased expression of AR. There is a positive association between ER alpha, ER beta, and
PGR
expression (P < 0.0001) and a negative association between AR and the androgen-regulated gene PAP expression in hormone-refractory tumors. Taken together, these data indicate that, although increased expression of the AR gene might play a key role in endocrine treatment failure, it cannot be considered as the sole actor of this unresolved dilemma, and abnormalities in ER alpha and/or ER beta expression may also modulate the growth response of
prostate cancer
to hormone withdrawal. Our results also suggest that ER alpha and ER beta expression status could be used to identify advanced prostate tumor patients who may respond to antiestrogen therapy.
...
PMID:Evaluation of androgen, estrogen (ER alpha and ER beta), and progesterone receptor expression in human prostate cancer by real-time quantitative reverse transcription-polymerase chain reaction assays. 1128 Jul 47
An 82-year old man received total androgen blockade therapy (bilateral orchiectomy and 375 mg/day flutamide) for the treatment of stage C prostate cancer. Serum PSA levels were undetectable for 13 months and thereafter increased gradually. We administered estramustine phosphate sodium (EPS) instead of flutamide under the diagnosis of hormone refractory prostate cancer. EPS therapy was discontinued after 9 months because serum PSA levels increased again. Then, the patient complained of bilateral breast nodules and pain. Bilateral mammectomies were performed due to bilateral breast cancers which had been diagnosed by aspiration biopsies and radiographic examinations, but he died four months after the operations. Final pathological diagnosis was ductal adenocarcinoma of the breasts. Immunohistochemical study revealed expressions of PSA in the breast cancers. We diagnosed double cancers of the prostate and the breast because of the different expression patterns of
progesterone receptor
between them. We review the literatures and discuss the differential diagnosis of
prostate cancer
and PSA-producing breast cancer.
...
PMID:[A male case of primary bilateral breast cancers during estrogen therapy for prostate cancer]. 1176 69
The androgen-signaling pathway is important for the growth and progression of
prostate cancer
cells. The growth-promoting effects of androgen on prostate cells are mediated mostly through the androgen receptor (AR). There is increasing evidence that transcription activation by AR is mediated through interaction with other cofactors. beta-Catenin plays a critical role in embryonic development and tumorigenesis through its effects on E-cadherin-mediated cell adhesion and Wnt-dependent signal transduction. Here, we demonstrate that a specific protein-protein interaction occurs between beta-catenin and AR. Unlike the steroid hormone receptor coactivator 1 (SRC1), beta-catenin showed a strong interaction with AR but not with other steroid hormone receptors such as estrogen receptor alpha,
progesterone receptor
beta, and glucocorticoid receptor. The ligand binding domain of AR and the NH(2) terminus combined with the first six armadillo repeats of beta-catenin were shown to be necessary for the interaction. Through this specific interaction, beta-catenin augments the ligand-dependent activity of AR in
prostate cancer
cells. Moreover, expression of E-cadherin in E-cadherin-negative
prostate cancer
cells results in redistribution of the cytoplasmic beta-catenin to the cell membrane and reduction of AR-mediated transcription. These data suggest that loss of E-cadherin can elevate the cellular levels of beta-catenin in
prostate cancer
cells, which may directly contribute to invasiveness and a more malignant tumor phenotype by augmenting AR activity during
prostate cancer
progression.
...
PMID:Linking beta-catenin to androgen-signaling pathway. 1179 9
We investigated the potential of genistein, the primary isoflavone of soy, to protect against breast and prostate cancers in animal models. For mammary cancer studies, Sprague-Dawley rats were fed AIN-76A diet plus minus 250 mg genistein/kg diet. Dimethylbenz[a]anthracene was administered by gavage at d 50 postpartum to induce mammary tumors. Mammary cancer chemoprevention was demonstrated after prepubertal and combined prepubertal and adult genistein treatments but not after prenatal- or adult-only treatments, demonstrating that the timing of exposure to genistein is important for mammary cancer chemoprevention. The cellular mechanism of action was found to be mammary gland and cell differentiation, as shown by whole-mount analysis and beta-casein expression. An imprinting effect was shown for epidermal growth factor receptor expression in mammary terminal end buds. For
prostate cancer
studies, we used two models. The first was a chemically (N-methylnitrosourea) induced
prostate cancer
rat model. Genistein in the diet inhibited the development of invasive adenocarcinomas in a dose-dependent manner. The second model was a transgenic mouse model that resulted in spontaneously developing adenocarcinoma tumor of the prostate. Genistein in the diet reduced the incidence of poorly differentiated prostatic adenocarcinomas in a dose-dependent manner and down-regulated androgen receptor, estrogen receptor-alpha,
progesterone receptor
, epidermal growth factor receptor, insulin-like growth factor-I, and extracellular signal-regulated kinase-1 but not estrogen receptor-beta and transforming growth factor-alpha mRNA expressions. We conclude that dietary genistein protects against mammary and prostate cancers by regulating specific sex steroid receptors and growth factor signaling pathways.
...
PMID:Genistein chemoprevention: timing and mechanisms of action in murine mammary and prostate. 1188 May 92
In the ligand-binding inactive state, the steroid receptor heterocomplex contains Hsp90, Hsp70, high-molecular weight immunophilins, and other proteins. Hsp90 acts in association with co-chaperones to maintain the native state of the receptor within the cells. It was reported earlier that Hsp90 might not be as important for the androgen receptor (AR) activity as for the glucocorticoid receptor (GR) and the
progesterone receptor
(PR) activities. We used the Hsp90 inhibitor geldanamycin (GA) to explore the role of Hsp90 in the function of the AR heterocomplex. GA selectively binds to Hsp90 and inhibits its activity, leading to the loss of steroid receptor activity, and frequently, its degradation. In our study, LNCaP
prostate cancer
cells were treated with GA for 30 minutes or 24 hours, in the presence of mibolerone, a synthetic androgen. GA reduced the androgen-induced AR protein levels to 15% after 24 hours of treatment. Several androgen up-regulated genes, including immunophilin FKBP51 and prostate specific antigen (PSA), were reduced by GA treatment. In cells treated with GA after transfection with a PSA promoter or an androgen response element-driven reporter gene, AR-mediated transactivation of reporter gene expression was reversibly inhibited by GA. Loss of androgen-binding ability and AR levels was attributed to reduced transcription of AR-regulated gene expression. Degradation rate of 35S-labeled AR was significantly increased by GA in the presence or absence of mibolerone. GA induced the degradation of AR through the proteasomal pathway. AR in cells treated with proteasomal inhibitor lactacystin, was insoluble in Nonidet P-40 (NP40)-based buffer and could not restore the androgen-binding ability. We report here that GA treatment disrupted both hormone-binding activity and receptor protein stability, resulting in a dramatic loss of androgen-induced gene activation. These results show that Hsp90 activity is important for both the chaperone-mediated folding of the AR into a high-affinity ligand-binding conformation and the functional activity of the AR.
...
PMID:Effect of geldanamycin on androgen receptor function and stability. 1189 40
Fibroblast growth factor 8 can transform NIH3T3 cells and its expression has been found to be associated with breast and
prostate cancer
. Following our finding that fibroblast growth factor 8 mRNA expression is increased in breast cancer, we have undertaken an immunohistochemistry study of fibroblast growth factor 8 expression in a series of human breast tissues and other normal tissues. Our findings confirm increased expression of fibroblast growth factor 8 in malignant breast tissue but also show significant fibroblast growth factor 8 expression in non-malignant breast epithelial cells. No significant difference in fibroblast growth factor 8 expression was found between different grades of ductal carcinoma, lobular carcinoma and ductal carcinoma in-situ or cancer of different oestrogen receptor,
progesterone receptor
or nodal status. The highest levels of fibroblast growth factor 8 expression were found in lactating breast tissues and fibroblast growth factor 8 was also detected in human milk. A survey of other normal tissues showed that fibroblast growth factor 8 is expressed in the proliferative cells of the dermis and epithelial cells in colon, ovary fallopian tube and uterus. Fibroblast growth factor 8 appears to be expressed in several organs in man and appears to have an importance in lactation.
...
PMID:Fibroblast growth factor 8 is expressed at higher levels in lactating human breast and in breast cancer. 1195 56
Due to the characteristics of the luteal phase of the ovarian cycle in the dog, which spans a prolonged time period, this species is a suitable model to study the role of progestins in both normal morphogenic and abnormal tumorigenic processes in the mammary gland. It has been convincingly shown that progestins, including endogenous progesterone, induce the synthesis of growth hormone (GH) in the normal and the tumorous canine mammary gland. The growth hormone receptor (GHR) is also expressed in normal and tumorous canine mammary tissues and in this concise overview we highlight recent advances in our understanding of the significance of the GH/GHR system for mammary gland (patho)biology. In an attempt to unravel the cellular and molecular mechanisms associated with the GH/GHR system, we were able to show that both GH and GHR are differentially expressed in normal canine mammary tissues. Maximum expression of both GH and GHR occurs during the proliferation phase of the tissue, which links the progestin-induced mammary GH synthesis to the progestin-associated proliferation of epithelial cells in the mammary gland. Expression of the GH/GHR system is also present in most canine mammary tumors, albeit that GHR expression may be downregulated in undifferentiated mammary carcinomas. Upon GH stimulation of the GHR-positive CMT-U335 canine mammary tumor cell line, the transcription factors STAT5A and STAT5B become phosphorylated on their tyrosine residues, which is likely to reflect the significance of mammary GH in vivo. Molecular analysis of the canine mammary GHR transcripts by RT-PCR provided evidence for normal and alternative processing of the GHR primary transcript encoding the full-length plasma membrane GHR and at least four putative GH binding proteins (GHBPs), respectively. The translation products from the alternatively spliced GHR transcripts indicate an intact N-terminal ligand binding domain and an unique C-terminal portion, lacking the transmembrane domain and cytoplasmic tail. Thus, these proteins are considered to be able to bind GH, but have lost their signaling potential. The exact biological role of these GHBPs remains to be established, but GHBPs may have a transport function in the endocrine route, regulate the level of biologically available GH locally, or dominant-negatively influence the full-length plasma membrane GHR. In dog mammary cancer specimens strongly reduced levels of alternatively spliced GHR transcripts were found compared to the non-malignant mammary tissue. Notably, expression of both GH and GHR in mammary cancer cells is not restricted to dogs. Recent experiments generated evidence for GH and GHR expression in human breast cancer cells, and also in human
prostate cancer
cells, which represents another highly prevalent hormone-sensitive human malignancy. In agreement with our findings in the dog, the expression of the hGH-N gene in human mammary cancer cells seemed to correlate positively with their
progesterone receptor
status, which warrants, in our opinion, a reconsideration of the role of progestins in breast cancer of women. In human
prostate cancer
cells four different hGH-N transcripts were detected, which encode classical 22 kDa GH and GH-related proteins. Consistent with the findings on the canine GHR, different GHR transcripts in human mammary cancer cells and
prostate cancer
cells were detected encoding the full-length plasma membrane GHR and putative GHBPs.
...
PMID:Morphogenic and tumorigenic potentials of the mammary growth hormone/growth hormone receptor system. 1243 8
<< Previous
1
2
3
4
5
6
7
8
9
Next >>