Gene/Protein Disease Symptom Drug Enzyme Compound
Pivot Concepts:   Target Concepts:
Query: UMLS:C0348321 (Haemophilus)
 15,372 document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)

Three oligonucleotide probes, complementary to tetM sequences, were labelled non-radiometrically using the DIG-oligonucleotide tailing kit and evaluated for their specificity for the detection of plasmid mediated tetracycline resistance in Neisseria gonorrhoeae. Only Probe 3, 5'-GCT CAA CAA TTC TGT TCC AGC-3', was specific for tetM. It hybridized with the tetM-containing 25.2-MDa plasmids from all of the 232 TRNG and the 130 PP/TRNG isolates used in the study. Its sensitivity, determined by dot-blot hybridization, was 0.1 pg of pJ13 plasmid DNA or 10(4) cells. It did not hybridize with the DNA from non-PPNG, CMRNG and tetracycline susceptible isolates from seven other Neisseria species (N. meningitidis, N. subflava, N. cinerea, N. lactamica, N. sicca, N. mucosa, and N. flavescens), Moraxella spp. and Haemophilus influenzae. Probe 3 also hybridized to DNA of three tetracycline resistant P. magnus (MIC = 16 micrograms ml-1) isolates which presumptively carried the tetM determinant. Therefore, probe 3 can be used by reference laboratories as a confirmatory test for TRNG, as well as isolates from other genera containing the tetM determinant.
 ...
PMID:Detection of the tetM determinant in Neisseria gonorrhoeae using a non-radioactively labelled oligonucleotide probe. 796 93

Partial nucleotide sequences of the sapD and sapF genes of the sap operon (GenBank Accession No. AF178651) from Vibrio fischeri ATCC 7744 have been determined, and the peptide transport system of ATP-binding proteins SapD and SapF encoded by the genes have been deduced. Alignment and comparison of the Sap proteins of V. fischeri, Escherichia coli, Salmonella typhimurium, and Haemophilus influenzae Rd show that these proteins are homologous. The sap operon residing in the genome enables V. fischeri to transport peptides and resist antimicrobial peptides. Nucleotide sequence and functional analyses confirm that the specific regulatory-region-like sequence R&R* that resides inside the sapD gene and before the sapF gene functions in gene expression and regulation; also, it is regulated by the LuxR-AI complex of the V. fischeri lux regulon. The putative upstream activator binding sequences SigmaUASI, SigmaUASII, SigmaUASIII TGTCGACTTGGGCCTCGCTGTCCGTATGCACA (72nd to 103rd bp), TGTCCGTATGCACA (90th to 103rd bp), and TGTTCAAGTACCAGAAAGACA (111st to 133rd bp) in the R&R* sequence, which are similar to the two-component regulator binding sequence TGT-N(8-12)-ACA and the LuxR-AI binding sequence ACCTGTAGGATCGTACAGGT in the regulatory region of the V. fischeri lux regulon, might be the specific sequences recognized by the LuxR-AI complex for enhancement.
 ...
PMID:Identification and analysis of the sap genes from Vibrio fischeri belonging to the ATP-binding cassette gene family required for peptide transport and resistance to antimicrobial peptides. 1072 Apr 87