Gene/Protein Disease Symptom Drug Enzyme Compound
Pivot Concepts:   Target Concepts:
Query: UMLS:C0348321 (Haemophilus)
 15,372 document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)

The binding of aromatic amino acids to the ligand response domain of the tyrosine repressor (TyrR) protein (TyrR(lrd)) of Haemophilus influenzae was investigated using circular dichroism and fluorescence spectroscopy. The induced secondary structural changes were unique for each aromatic amino acid and were further influenced by the presence or absence of ATP. Tyrosine was found to have the highest affinity for TyrR(lrd) in the absence of ATP, whereas the affinity for ATP itself increased in the presence of tyrosine. Binding of tyrosine is therefore the conformational trigger for the activation of TyrR whereas ATP is regarded as a conformational co-activator.
 ...
PMID:The influence of ATP on the binding of aromatic amino acids to the ligand response domain of the tyrosine repressor of Haemophilus influenzae. 1066 62

Partial nucleotide sequences of the sapD and sapF genes of the sap operon (GenBank Accession No. AF178651) from Vibrio fischeri ATCC 7744 have been determined, and the peptide transport system of ATP-binding proteins SapD and SapF encoded by the genes have been deduced. Alignment and comparison of the Sap proteins of V. fischeri, Escherichia coli, Salmonella typhimurium, and Haemophilus influenzae Rd show that these proteins are homologous. The sap operon residing in the genome enables V. fischeri to transport peptides and resist antimicrobial peptides. Nucleotide sequence and functional analyses confirm that the specific regulatory-region-like sequence R&R* that resides inside the sapD gene and before the sapF gene functions in gene expression and regulation; also, it is regulated by the LuxR-AI complex of the V. fischeri lux regulon. The putative upstream activator binding sequences SigmaUASI, SigmaUASII, SigmaUASIII TGTCGACTTGGGCCTCGCTGTCCGTATGCACA (72nd to 103rd bp), TGTCCGTATGCACA (90th to 103rd bp), and TGTTCAAGTACCAGAAAGACA (111st to 133rd bp) in the R&R* sequence, which are similar to the two-component regulator binding sequence TGT-N(8-12)-ACA and the LuxR-AI binding sequence ACCTGTAGGATCGTACAGGT in the regulatory region of the V. fischeri lux regulon, might be the specific sequences recognized by the LuxR-AI complex for enhancement.
 ...
PMID:Identification and analysis of the sap genes from Vibrio fischeri belonging to the ATP-binding cassette gene family required for peptide transport and resistance to antimicrobial peptides. 1072 Apr 87

Macrolide antibiotics (Mac) consist of a 12- to 16-membered lactone ring combined with a sugar moiety, and they inhibit protein synthesis via binding to 23S ribosomal RNA in bacteria. The 14- and 16-membered Mac are used for treating infectious diseases caused by Gram-positive and other bacteria; e.g., Haemophilus influenzae, Bordetella pertussis, Legionella pneumophila, Campylobacter, Treponema pallidum and Mycoplasma. Resistance to macrolide, lincosamide, and streptogramin-B (MLS) antibiotics in staphylococci is known to have the following mechanisms: 1) alteration of the target on ribosome due to dimethylation of a specific adenine residue in the 23S ribosomal RNA by the product of the erm gene, and consequently a decrease in binding of MLS antibiotics; 2) inactivation of streptogramin-B (STG-B) and lincosamide by the products of the sbh (encoding streptogramin B hydrolase) and linA' (encoding 3-lincomycin 4-clindamycin O-nucleotidyltransferase) genes, respectively; and 3) active efflux of Mac and STG-B antibiotics determined by the msrA and msrB genes in Staphylococcus epidermidis and Staphylococcus xylosus, respectively, both of which appear to act as an ATP-dependent efflux pump. I have shown that Staphylococcus aureus 8325(pEP2104) exhibits inducible resistance to PMS (partial macrolide and streptogramin B)-antibiotics [the 14-membered macrolides, erythromycin (EM), and oleandomycin (OL), and the 16-membered macrolide mycinamicin (MCM) and STG-B]. The sequence of the N-terminal amino acid residues of a 63 kDa protein (MsrSA) that appeared in the membrane of PMS-resistant strains was identical to that of an MsrA polypeptide related to enhanced efflux of [14C]EM. Ribosomes from PMS-resistant strains showed a similar affinity for EM to those from the PMS-sensitive host strain NCTC8325, and no inactivation of EM by 8325(pEP2104) was observed. In the present study, I showed the DNA sequence of the msrSA region on the constitutive PMS-resistant plasmid pMC38, PMS-inducible resistant plasmid pEP2104 and PMS-sensitive mutant plasmid pSP6, and the region that is essential for inducible expression in PMS resistance. In addition, I investigated the relationship between PMS resistance and intracellular accumulation of EM.
 ...
PMID:[Study of macrolide, lincosamide, and streptogramin B antibiotics resistance in Staphylococcus aureus]. 1077 59

Brucella abortus actively secretes materials and uptakes nutrients to maintain the survival and multiplication of the bacteria in host cells. ATP-binding cassette (ABC) transporters can uptake or secrete diverse materials across the bacterial membrane, and thus, ABC transporters may be important for survival of the pathogen in the host. In the present study, the B. abortus genes encoding tandem repeated Brucella ATP-binding proteins, BapA and BapB, were identified. The deduced amino acid sequences of these two genes place BapA and BapB into group 6 containing RTX toxin transporters and cyclic beta-1,2-glucan transporters, one of 25 ABC transporter ortholog groups. One of the ortholog group 6 proteins, Haemophilus influenzae LktB, shows the highest similarity and identity with these two Brucella proteins. To test the role of these putative tandem repeated ABC transporters in Brucella pathogenesis, a bap deletion mutant was constructed and used to infect murine RAW 264.7 macrophages and mice. The number of cfu from RAW 264.7 cells and spleens of BALB/c mice infected with wild type or the bap deletion mutant was similar during the course of infection, suggesting the bap genes are not necessary to maintain the pathogenesis of B. abortus, or alternative compensatory mechanisms may exist to permit the intracellular survival of B. abortus in vitro and in vivo. This is the first molecular approach to investigate the role of putative ABC transporters classified into ortholog group 6 in Brucella pathogenesis.
 ...
PMID:Brucella abortus tandem repeated ATP-binding proteins, BapA and BapB, homologs of haemophilus influenzae LktB, are not necessary for intracellular survival. 1099 43

The comparative approach is a powerful tool for the analysis of gene regulation in bacterial genomes. It can be applied to the analysis of regulons that have been studied experimentally as well as that of regulons for which no known regulatory sites are available. It is assumed that the set of co-regulated genes and the regulatory signal itself are conserved in related genomes. Here, we use genomic comparisons to study the regulation of transport and utilization systems for sugar acids in gamma purple bacteria Escherichia coli, Salmonella typhi, Klebsiella pneumoniae, Yersinia pestis, Erwinia chrysanthemi, Haemophilus influenzae and Vibrio cholerae. The variability of the operon structure and the location of the operator sites for the main transcription factors are demonstrated. The common metabolic map is combined with known and predicted regulatory interactions. It includes all known and predicted members of the GntR, UxuR/ExuR, KdgR, UidR and IdnR regulons. Moreover, most members of these regulons seem to be under catabolite repression mediated by CRP. The candidate UxuR/ExuR signal is proposed, the KdgR consensus is extended, and new operators for all transcription factors are identified in all studied genomes. Two new members of the KdgR regulon, a hypothetical ATP-dependent transport system OgtABCD and YjgK protein with unknown function, are detected. The former is likely to be the transport system for the products of pectin degradation, oligogalacturonides.
 ...
PMID:Transcriptional regulation of transport and utilization systems for hexuronides, hexuronates and hexonates in gamma purple bacteria. 1111 4

The secondary structure of the ligand response domain of the Haemophilus influenzae tyrosine repressor, TyrR(lrd), was investigated using CD spectroscopy which revealed 42.5% alpha-helix, 17.6% beta-sheet, and 39.9% loops. Quaternary structure analysis by fluorescence anisotropy showed that TyrR(lrd) is monomeric at a concentration of 100 nM to 2 microM but that the protein readily dimerizes in the presence of its natural ligand ATP. Equilibrium unfolding studies of TyrR(lrd) using guanidinium hydrochloride suggested a two-state model with no detectable stable intermediates. The unfolding transition monitored by CD spectroscopy was responsive to tyrosine and ATP resulting in a shift to higher denaturant concentrations in the presence of these ligands. Differential scanning calorimetry yielded melting temperatures, T(m), of 51.15 and 58.07 degrees C for the unliganded and for the ATP-liganded protein, respectively. ATP is thus proposed to be a major structural cofactor for the molecular architecture of TyrR(lrd).
 ...
PMID:The influence of ATP on the association and unfolding of the tyrosine repressor ligand response domain of Haemophilus influenzae. 1116 81

Dephospho-coenzyme A kinase catalyzes the final step in CoA biosynthesis, the phosphorylation of the 3'-hydroxyl group of ribose using ATP as a phosphate donor. The protein from Haemophilus influenzae was cloned and expressed, and its crystal structure was determined at 2.0-A resolution in complex with ATP. The protein molecule consists of three domains: the canonical nucleotide-binding domain with a five-stranded parallel beta-sheet, the substrate-binding alpha-helical domain, and the lid domain formed by a pair of alpha-helices. The overall topology of the protein resembles the structures of nucleotide kinases. ATP binds in the P-loop in a manner observed in other kinases. The CoA-binding site is located at the interface of all three domains. The double-pocket structure of the substrate-binding site is unusual for nucleotide kinases. Amino acid residues implicated in substrate binding and catalysis have been identified. The structure analysis suggests large domain movements during the catalytic cycle.
 ...
PMID:Crystal structure of dephospho-coenzyme A kinase from Haemophilus influenzae. 1188 13

Numerous bacterial proteins are involved in microbial iron uptake and transport and considerable variation has been found in the uptake schemes used by different bacterial species. However, whether extracting iron from host proteins such as transferrin, lactoferrin or hemoglobin or importing low molecular weight iron-chelating compounds such as heme, citrate or siderophores, Gram-negative pathogenic bacteria typically employ a specific outer membrane receptor, a periplasmic binding protein and two inner membrane associated proteins: a transporter coupled with an ATP-hydrolyzing protein. Often, studies have shown that proteins with similar function but little amino acid sequence homology are structurally related. Elucidation of the structures of the Escherichia coli outer membrane siderophore transport proteins FepA and FhuA have provided the first insights into the conformational changes required for ligand transport through the bacterial outer membrane. The variations between the structures of the prototypical periplasmic ferric binding protein FbpA from Neisseria and Haemophilus influenzae and the unusual E coli periplasmic siderophore binding protein FhuD reveal that the different periplasmic ligand binding proteins exercise distinct mechanisms for ligand binding and release. The structure of the hemophore HasA from Serratia marcescens shows how heme may be extracted and utilized by the bacteria. Other biochemical evidence also shows that the proteins that provide energy for iron transport at the outer membrane, such as the TonB-ExbB-ExbD system, are structurally very similar across bacterial species. Likewise, the iron-sensitive gene regulatory protein Fur is found in most bacteria. To date, no structural information is available for Fur, but the structure for the related protein DxtR has been determined. Together, these three-dimensional structures complement our knowledge of iron transport systems from other pathogenic bacteria, including Pseudomonas aeruginosa, which has a number of homologous iron uptake proteins. More importantly, the current structures for iron transport proteins provide rational starting points for design of novel antimicrobial agents.
 ...
PMID:Structural biology of bacterial iron uptake systems. 1189 94

A hypothetical protein encoded by the gene YjeE of Haemophilus influenzae was selected as part of a structural genomics project for X-ray analysis to assist with the functional assignment. The protein is considered essential to bacteria because the gene is present in virtually all bacterial genomes but not in those of archaea or eukaryotes. The amino acid sequence shows no homology to other proteins except for the presence of the Walker A motif G-X-X-X-X-G-K-T that indicates the possibility of a nucleotide-binding protein. The YjeE protein was cloned, expressed, and the crystal structure determined by the MAD method at 1.7-A resolution. The protein has a nucleotide-binding fold with a four-stranded parallel beta-sheet flanked by antiparallel beta-strands on each side. The topology of the beta-sheet is unique among P-loop proteins and has features of different families of enzymes. Crystallization of YjeE in the presence of ATP and Mg2+ resulted in the structure with ADP bound in the P-loop. The ATPase activity of YjeE was confirmed by kinetic measurements. The distribution of conserved residues suggests that the protein may work as a "molecular switch" triggered by ATP hydrolysis. The phylogenetic pattern of YjeE suggests its involvement in cell wall biosynthesis.
 ...
PMID:Crystal structure of the YjeE protein from Haemophilus influenzae: a putative Atpase involved in cell wall synthesis. 1211 91

Structural genomics is a new approach in functional assignment of proteins identified via whole-genome sequencing programs. Its rationale is that nonhomologous proteins performing similar or related biological functions might have similar tertiary structure. We used dye pseudoaffinity chromatography, two-dimensional gel electrophoresis, and mass spectrometry to identify two novel Escherichia coli nucleotide-binding proteins, YnaF and YajQ. YnaF exhibited significant sequence identity with MJ0577, an ATP-binding protein from a hyperthermophile (Methanococcus jannaschii), and with UspA, a protein from Haemophilus influenzae that belongs to the Universal Stress Protein family. YnaF conserves the ATP-binding site and the dimeric structure observed in the crystal of MJ0577. The protein YajQ, present in many bacterial genomes, is missing in eukaryotes. In the absence of significant similarities of YajQ to any solved structure, we determined its structural and ligand-binding properties by NMR and isothermal titration calorimetry. We demonstrate that YajQ is composed of two domains, each centered on a beta-sheet, that are connected by two helical segments. NMR studies, corroborated with local sequence conservation among YajQ homologs in various bacteria, indicate that one of the beta-sheets is mostly involved in biological activity.
 ...
PMID:Structural and nucleotide-binding properties of YajQ and YnaF, two Escherichia coli proteins of unknown function. 1238 39


<< Previous 1 2 3 4 5 6 7 8 9 10 Next >>