Gene/Protein Disease Symptom Drug Enzyme Compound
Pivot Concepts:   Target Concepts:
Query: UMLS:C0348321 (Haemophilus)
15,372 document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)

An in vitro blood-brain barrier (BBB) model consisting of primary cultures of bovine brain microvascular endothelial cells was used to examine the effect of Haemophilus influenzae type b (Hib) on the BBB. Whole bacteria and purified lipopolysaccharide (LPS; greater than 10 ng/ml) caused marked cytotoxicity on the bovine brain endothelial cells. This effect could be completely blocked by polymyxin B. Similar cytotoxic effects were observed with a cultured bovine pulmonary endothelial cell line. Serum was essential for the LPS-mediated cytotoxic effect, and human, horse, bovine, or fetal calf serum all had similar effects. The serum factor was not a complement component. A monoclonal antibody against CD14, a receptor involved in mediating the effect of LPS in monocytes, completely blocked the cytotoxic effect in both brain and pulmonary endothelial cells. These results suggest that Hib LPS disrupts an in vitro BBB model via a serum- and CD14-dependent pathway and that LPS has cytotoxic effects on bovine endothelial cells without the involvement of monocytic cells, an effect that may be important in gram-negative meningitis and in endotoxic shock.
...
PMID:Haemophilus influenzae lipopolysaccharide disrupts confluent monolayers of bovine brain endothelial cells via a serum-dependent cytotoxic pathway. 137 54

The DNA oligomer 5'-d(TGCGGCCTCTCAGTCCCGCACTTTCATCTTCC)-3' specifically recognizes Haemophilus influenzae 16S rRNA. We report here the use of this oligonucleotide, with a fluorescein label tagged on its 5' end, as a probe for the in situ detection of nonencapsulated nontypeable H. influenzae in sections of adenoid tissue from 10 children who were clinically infection free but were having their adenoids removed because of nasal obstruction. In some cases, the reticular crypt epithelium was focally infiltrated by H. influenzae. The reservoir for these bacterial colonizations, in all likelihood long standing, seemed to be macrophage-like cells found in the subepithelial layers in all 10 cases. These mononuclear cells contained up to 200 intracellular H. influenzae cells. In the transmission electron macroscope, macrophage-like cells with intracellular bacteria with coccoid morphology, at least some of which were dividing, were seen. Adenoid cell suspensions, enriched for macrophages by use of paramagnetic beads coated with monoclonal antibodies against the CD14 marker, yielded up to 1,100 CFU of nontypeable H. influenzae per 10(5) cells after killing of extracellular bacteria with gentamicin followed by mechanical lysis of the cells.
...
PMID:Haemophilus influenzae resides and multiplies intracellularly in human adenoid tissue as demonstrated by in situ hybridization and bacterial viability assay. 750

In response to bacterial lipopolysaccharides (LPS; endotoxin), endothelial cells are converted to an activation phenotype expressing both proinflammatory and procoagulant properties that include the induction of leukocyte adhesion molecules and tissue factor expression. LPS-induced endothelial cell activation requires a soluble form of the monocyte LPS receptor, sCD14. We evaluated the capacity of multiple strains of gram-negative and gram-positive bacteria to induce endothelial E-selectin and tissue factor expression through sCD14-dependent pathways with cultured human umbilical vein endothelial cells (HUVE). Both viable and heat-killed gram-negative bacteria (Bacteroides fragilis, Enterobacter cloacae, Haemophilus influenzae, and Klebsiella pneumoniae) but not viable or heat-killed gram-positive bacteria (Staphylococcus aureus, Enterococcus faecalis, and Streptococcus pneumoniae) induced prominent E-selectin surface expression detected by enzyme-linked immunosorbent assay. Tissue factor activity on HUVE, indicated by factor X activation, was induced in response to gram-negative bacteria but not in response to gram-positive bacteria. Gram-negative bacteria induced transcriptional activation in HUVE, indicated by the appearance of E-selectin-specific mRNA and by the demonstration of activation of NF-kappa B, a trans-activating factor necessary for E-selectin and tissue factor gene transcription. In contrast, neither E-selectin mRNA nor activation of NF-kappa B was detected in HUVE treated with gram-positive bacteria. Endothelial cell activation by gram-negative bacteria in each of these assays was inhibited with a monoclonal antibody (60bd) against CD14. Furthermore, CHO-K1 cells, transfected with human recombinant CD14, responded to all strains of gram-negative bacteria (viable or heat killed), indicated by CHO-K1 NF-kappa B activation. We conclude that gram-negative bacteria induce endothelial cell activation through a common sCD14-dependent pathway.
...
PMID:Activation of human endothelial cells by viable or heat-killed gram-negative bacteria requires soluble CD14. 755 18

In previous studies, we have shown that intact, heat-killed, gram-negative bacteria (GNB) and gram-positive bacteria (GPB) can stimulate the production of various proinflammatory and anti-inflammatory cytokines. The objective of the present study was to investigate whether the production of tumor necrosis factor alpha (TNF) and interleukin-10 (IL-10) by human monocytes stimulated by intact heat-killed or live Haemophilus influenzae or Streptococcus pneumoniae is mediated by CD14. Two anti-CD14 monoclonal antibodies (MAbs) were used to study the interaction between human monocytes and bacteria; lipopolysaccharide (LPS) was used to validate the effect of anti-CD14 MAb. MAb 18E12 decreased significantly TNF and IL-10 production upon stimulation with LPS or heat-killed bacteria and TNF production during stimulation by live bacteria. MAb My-4 decreased production of TNF and IL-10 by monocytes stimulated with LPS, IL-10 but not TNF production upon stimulation with heat-killed H. influenzae, and production of neither TNF nor IL-10 upon stimulation with S. pneumoniae. Together, these results led to the conclusion that CD14 is involved in the recognition and stimulation of human monocytes by intact GNB and GPB. Consequentially, the option for adjunctive treatment of severe infections with anti-CD14 MAb is postulated.
...
PMID:Anti-CD14 monoclonal antibodies inhibit the production of tumor necrosis factor alpha and interleukin-10 by human monocytes stimulated with killed and live Haemophilus influenzae or Streptococcus pneumoniae organisms. 1041 28

Non-typable Haemophilus influenzae, Streptococcus pneumoniae, Moraxella catarrhalis and respiratory syncytial virus (RSV) are commonly isolated from patients during the course of chronic obstructive pulmonary disease (COPD). Earlier studies found that virus infection enhanced binding of bacterial respiratory pathogens to epithelial cells in vitro. The objective of the present study was to assess the effect of RSV infection of a human monocytic cell line on bactericidal activity and cytokine production in response to these bacterial respiratory pathogens. The effect of RSV infection on binding, uptake and intracellular killing of bacteria by a human monocytic leukaemia cell line, THP-1, was assessed. Cell culture supernates were examined with a mouse fibroblast cell assay for tumour necrosis factor-alpha (TNF-alpha) bioactivity. Expression of CD14, CD11a, CD18, CD15 and CD29 on uninfected and RSV-infected THP-1 cells was assessed by flow cytometry in relation to differences in bacterial binding. RSV infection of THP-1 cells significantly decreased their ability to bind and kill bacteria. Compared with uninfected cells, fewer bacteria bound to RSV-infected THP-1 cells and the surface antigens that have been reported to bind bacteria were expressed at lower levels on RSV-infected cells. RSV-infected cells incubated with bacteria exhibited less TNF-alpha bioactivity than uninfected cell incubated with bacteria. The results elucidate some of the mechanisms involved in the increased susceptibility of virus-infected patients to secondary bacterial infection. Reduced bacterial killing by virus-infected monocytes might contribute to reduced clearance of bacteria from the respiratory tract and damage elicited by the bacteria or cytokine response in COPD patients.
...
PMID:Bactericidal activity of a monocytic cell line (THP-1) against common respiratory tract bacterial pathogens is depressed after infection with respiratory syncytial virus. 1070 42

Haemophilus influenzae is the bacterial species most often isolated from sputum of patients with chronic obstructive pulmonary disease (COPD). In this study, we examined the induction of interleukin-5 (IL-5) mRNA expression in human peripheral blood mononuclear cells (PBMC) stimulated with lipopolysaccharide (LPS) from H. influenzae to try to predict the effect of H. influenzae infection on the eosinophilic inflammation in COPD. Detection of IL-5 mRNA by RT-PCR showed that LPS from H. influenzae induced IL-5 mRNA expression in PBMC at a concentration of 1 microg/ml. Furthermore, the level of expression of IL-5 mRNA induced by LPS correlated with the amount of IL-5 protein in the culture supernatant. Inhibition of LPS-induced IL-5 mRNA expression by anti-CD14 antibody and diminution of this in a CD3(+) -cell-depleted fraction of PBMC, respectively, suggested that CD14 molecules were required for the increase in IL-5 mRNA and that T lymphocytes were the principal source of IL-5 mRNA expression in PBMC. Briefly, the IL-5 mRNA expression induced by LPS would be based on LPS-activated monocytes interacting with T lymphocytes to produce IL-5. These results may explain the role that colonization with H. influenzae plays in eosinophilic inflammation in patients with COPD.
...
PMID:Lipopolysaccharide of Haemophilus influenzae induces interleukin-5 mRNA expression in human peripheral blood mononuclear cells. 1144 Jun 42

Nontypeable Haemophilus influenzae (NTHi) is a common cause of respiratory tract infections. This study investigated the ability of NTHi to bind lipopolysaccharide-binding protein (LBP) derived from respiratory epithelial cells and the subsequent stimulation of transfected cells expressing membrane-bound CD14 and toll-like receptor 2 (TLR2) or TLR4. In the absence of LBP, NTHi at high concentrations (100 bacteria/epithelial cell) were required to induce signals through TLR2 and TLR4. Flow cytometry showed that NTHi in the stationary phase bound more LBP than did log-phase bacteria. Of interest, as few as 1 LBP-bearing bacterium/cell induced strong signaling through TLR4. In contrast, LBP bound to NTHi did not promote any increased signaling mediated by TLR2, compared with NTHi without LBP. These data suggest that, upon NTHi infection, low numbers of bacteria binding LBP may activate TLR4-bearing cells, such as alveolar macrophages, and consequently induce an inflammatory response.
...
PMID:Lipopolysaccharide-binding protein increases toll-like receptor 4-dependent activation by nontypeable Haemophilus influenzae. 1152 97

The expression of inducible antimicrobial peptides, such as human beta-defensin-2 (HBD-2) by epithelia, comprises a component of innate pulmonary defenses. We hypothesized that HBD-2 induction in airway epithelia is linked to pattern recognition receptors such as the Toll-like receptors (TLRs). We found that primary cultures of well-differentiated human airway epithelia express the mRNA for TLR-4, but little or no MD-2 mRNA, and display little HBD-2 expression in response to treatment with purified endotoxin +/- LPS binding protein (LBP) and soluble CD14. Expression of endogenous MD-2 by transduction of airway epithelial cells with an adenoviral vector encoding MD-2 or extracellular addition of recombinant MD-2 both increased the responses of airway epithelia to endotoxin + LBP and sCD14 by >100-fold, as measured by NF-kappaB-luciferase activity and HBD-2 mRNA expression. MD-2 mRNA could be induced in airway epithelia by exposure of these cells to specific bacterial or host products (e.g., killed Haemophilus influenzae, the P6 outer membrane protein from H. influenzae, or TNF-alpha + IFN-gamma). These findings suggest that MD-2, either coexpressed with TLR-4 or secreted when produced in excess of TLR-4 from neighboring cells, is required for airway epithelia to respond sensitively to endotoxin. The regulation of MD-2 expression in airway epithelia and pulmonary macrophages may serve as a means to modify endotoxin responsiveness in the airway.
...
PMID:Endotoxin responsiveness of human airway epithelia is limited by low expression of MD-2. 1512 39

TLRs are important for the recognition of conserved motifs expressed by invading bacteria. TLR4 is the signaling receptor for LPS, the major proinflammatory component of the Gram-negative cell wall, whereas CD14 serves as the ligand-binding part of the LPS receptor complex. Triggering of TLR4 results in the activation of two distinct intracellular pathways, one that relies on the common TLR adaptor MyD88 and one that is mediated by Toll/IL-1R domain-containing adaptor-inducing IFN-beta (TRIF). Nontypeable Haemophilus influenzae (NTHi) is a common Gram-negative respiratory pathogen that expresses both TLR4 (LPS and lipooligosaccharide) and TLR2 (lipoproteins) ligands. To determine the roles of CD14, TLR4, and TLR2 during NTHi pneumonia, the following studies were performed: 1) Alveolar macrophages from CD14 and TLR4 knockout (KO) mice were virtually unresponsive to NTHi in vitro, whereas TLR2 KO macrophages displayed a reduced NTHi responsiveness. 2) After intranasal infection with NTHi, CD14 and TLR4 KO mice showed an attenuated early inflammatory response in their lungs, which was associated with a strongly reduced clearance of NTHi from the respiratory tract; in contrast, in TLR2 KO mice, lung inflammation was unchanged, and the number of NTHi CFU was only modestly increased at the end of the 10-day observation period. 3) MyD88 KO, but not TRIF mutant mice showed an increased bacterial load in their lungs upon infection with NTHi. These data suggest that the MyD88-dependent pathway of TLR4 is important for an effective innate immune response to respiratory tract infection caused by NTHi.
...
PMID:The MyD88-dependent, but not the MyD88-independent, pathway of TLR4 signaling is important in clearing nontypeable haemophilus influenzae from the mouse lung. 1623 99

Lipopolysaccharide-binding protein (LBP) and CD14 contribute to the recognition of pathogens by cells, which triggers the activation of defence responses. Smoking is a risk factor for the development of chronic obstructive pulmonary disease (COPD) and respiratory infections. The current authors theorised that levels of LBP and CD14 in the lungs of smokers would be higher than those in the lungs of never-smokers. These elevated levels could affect host responses upon infection. LBP, soluble CD14 (sCD14) and interleukin (IL)-8 were detected by ELISA. Nuclear factor (NF)-kappaB, p38 and the inhibitor IkappaBalpha were studied by immunoassays. Gene expression was assessed by RT-PCR. Bronchoalveolar lavage levels of LBP and CD14 were significantly higher in smokers and COPD patients than in never-smokers, whereas levels of both proteins were not significantly different between smokers and COPD patients. IL-6, IL-1beta and cigarette smoke condensate induced the expression of LBP and CD14 by airway epithelial cells. LBP and sCD14 inhibited the nontypeable Haemophilus influenzae (NTHi)-dependent secretion of IL-8 and the activation of NF-kappaB and p38 mitogen-activated protein kinase signalling pathways but they increased the internalisation of NTHi by airway epithelial cells. Thus, in the inflamed airways of smokers both proteins could contribute to inhibit bacteria-dependent cellular activation without compromising the internalisation of pathogens by airway cells.
...
PMID:Lipopolysaccharide-binding protein and CD14 are increased in the bronchoalveolar lavage fluid of smokers. 1901 Sep 86


1 2 Next >>