Gene/Protein Disease Symptom Drug Enzyme Compound
Pivot Concepts:   Target Concepts:
Query: UMLS:C0240066 (iron deficiency)
 7,156 document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)

The molecular mechanisms of plant responses to iron (Fe) deficiency remain largely unknown. To identify the cis-acting elements responsible for Fe-deficiency-inducible expression in higher plants, the barley IDS2 (iron deficiency specific clone no. 2) gene promoter was analyzed using a transgenic tobacco system. Deletion analysis revealed that the sequence between -272 and -91 from the translational start site (-272/-91) was both sufficient and necessary for specific expression in tobacco roots. Further deletion and linker-scanning analysis of this region clearly identified two cis-acting elements: iron-deficiency-responsive element 1 (IDE1) at -153/-136 (ATCAAGCATGCTTCTTGC) and IDE2 at -262/-236 (TTGAACGGCAAGTTTCACGCTGTCACT). The co-existence of IDE1 and IDE2 was essential for specific expression when the -46/+8 region (relative to the transcriptional start site) of the CaMV 35S promoter was used as a minimal promoter. Expression occurred mainly in the root pericycle, endodermis, and cortex. When the -90/+8 region of the CaMV 35S promoter was fused, the -272/-227 region, which consists of IDE2 and an additional 19 bp, could drive Fe-deficiency-inducible expression without IDE1 throughout almost the entire root. The principal modules of IDE1 and IDE2 were homologous. Sequences homologous to IDE1 were also found in many other Fe-deficiency-inducible promoters, including: nicotianamine aminotransferase (HvNAAT)-A, HvNAAT-B, nicotianamine synthase (HvNAS1), HvIDS3, OsNAS1, OsNAS2, OsIRT1, AtIRT1, and AtFRO2, suggesting the conservation of cis-acting elements in various genes and species. The identification of novel cis-acting elements, IDE1 and IDE2, will provide powerful tools to clarify the molecular mechanisms regulating Fe homeostasis in higher plants.
 ...
PMID:Identification of novel cis-acting elements, IDE1 and IDE2, of the barley IDS2 gene promoter conferring iron-deficiency-inducible, root-specific expression in heterogeneous tobacco plants. 1467 44

Iron deficiency is a serious problem around the world, especially in developing countries. The production of iron-biofortified rice will help ameliorate this problem. Previously, expression of the iron storage protein, ferritin, in rice using an endosperm-specific promoter resulted in a two-fold increase in iron concentration in the resultant transgenic seeds. However, further over expression of ferritin did not produce an additional increase in the seed iron concentration, and symptoms of iron deficiency were noted in the leaves of the transgenic plants. In the present study, we aimed to further increase the iron concentration in rice seeds without increasing the sensitivity to iron deficiency by enhancing the uptake and transport of iron via a ferric iron chelator, mugineic acid. To this end, we introduced the soybean ferritin gene (SoyferH2) driven by two endosperm-specific promoters, along with the barley nicotianamine synthase gene (HvNAS1), two nicotianamine aminotransferase genes (HvNAAT-A and -B), and a mugineic acid synthase gene (IDS3) to enhance mugineic acid production in rice plants. A marker-free vector was utilized as a means of increasing public acceptance. Representative lines were selected from 102 transformants based on the iron concentration in polished seeds and ferritin accumulation in the seeds. These lines were grown in both commercially supplied soil (iron-sufficient conditions) and calcareous soil (iron-deficient conditions). Lines expressing both ferritin and mugineic acid biosynthetic genes showed signs of iron-deficiency tolerance in calcareous soil. The iron concentration in polished T3 seeds was increased by 4 and 2.5 times, as compared to that in non-transgenic lines grown in normal and calcareous soil, respectively. These results indicate that the concomitant introduction of the ferritin gene and mugineic acid biosynthetic genes effectively increased the seed iron level without causing iron sensitivity under iron-limited conditions.
 ...
PMID:Iron-biofortification in rice by the introduction of three barley genes participated in mugineic acid biosynthesis with soybean ferritin gene. 2367 79

Iron (Fe) is an essential element required for plant growth and development. Under Fe-deficientconditions, plants have developed two distinct strategies (designated as strategy I and II) to acquire Fe from soil. As a graminaceous species, rice is not a typical strategy II plant, as it not only synthesizes DMA (2'-deoxymugineic acid) in roots to chelate Fe3+ but also acquires Fe2+ through transporters OsIRT1 and OsIRT2. During the synthesis of DMA in rice, there are three sequential enzymatic reactions catalyzed by enzymes NAS (nicotianamine synthase), NAAT (nicotianamine aminotransferase), and DMAS (deoxymugineic acid synthase). Many transporters required for Fe uptake from the rhizosphere and internal translocation have also been identified in rice. In addition, the signaling networks composed of various transcription factors (such as IDEF1, IDEF2, and members of the bHLH (basic helix-loop-helix) family), phytohormones, and signaling molecules are demonstrated to regulate Fe uptake and translocation. This knowledge greatly contributes to our understanding of the molecular mechanisms underlying iron deficiency responses in rice.
 ...
PMID:The Molecular Mechanisms Underlying Iron Deficiency Responses in Rice. 3186 87