Gene/Protein Disease Symptom Drug Enzyme Compound
Pivot Concepts:   Target Concepts:
Query: UMLS:C0240066 (iron deficiency)
7,156 document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)

Metal transporters regulated by iron can transport a variety of divalent metals, suggesting that iron regulation is important for specificity of iron transport. In plants, the iron-regulated broad-range metal transporter IRT1 is required for uptake of iron into the root epidermis. Functions of other iron-regulated plant metal transporters are not yet established. To deduce novel plant iron transport functions we studied the regulation of four tomato metal transporter genes belonging to the nramp and irt families with respect to environmental and genetic factors influencing iron uptake. We isolated Lenramp1 and Lenramp3 from tomato and demonstrate that these genes encode functional NRAMP metal transporters in yeast, where they were iron-regulated and localized mainly to intracellular vesicles. Lenramp1 and Leirt1 revealed both root-specific expression and up-regulation by iron deficiency, respectively, in contrast to Leirt2 and Lenramp3. Lenramp1 and Leirt1, but not Lenramp3 and Leirt2, were down-regulated in the roots of fer mutant plants deficient in a bHLH gene regulating iron uptake. In chloronerva mutant plants lacking the functional enzyme for synthesis of the plant-specific metal chelator nicotianamine Leirt1 and Lenramp1 were up-regulated despite sufficient iron supply independent of a functional fer gene. Lenramp1 was expressed in the vascular root parenchyma in a similar cellular pattern as the fer gene. However, the fer gene was not sufficient for inducing Lenramp1 and Leirt1 when ectopically expressed. Based on our results, we suggest a novel function for NRAMP1 in mobilizing iron in the vascular parenchyma upon iron deficiency in plants. We discuss fer/nicotianamine synthase-dependent and -independent regulatory pathways for metal transporter gene regulation.
...
PMID:Differential regulation of nramp and irt metal transporter genes in wild type and iron uptake mutants of tomato. 1270 25

The molecular mechanisms of plant responses to iron (Fe) deficiency remain largely unknown. To identify the cis-acting elements responsible for Fe-deficiency-inducible expression in higher plants, the barley IDS2 (iron deficiency specific clone no. 2) gene promoter was analyzed using a transgenic tobacco system. Deletion analysis revealed that the sequence between -272 and -91 from the translational start site (-272/-91) was both sufficient and necessary for specific expression in tobacco roots. Further deletion and linker-scanning analysis of this region clearly identified two cis-acting elements: iron-deficiency-responsive element 1 (IDE1) at -153/-136 (ATCAAGCATGCTTCTTGC) and IDE2 at -262/-236 (TTGAACGGCAAGTTTCACGCTGTCACT). The co-existence of IDE1 and IDE2 was essential for specific expression when the -46/+8 region (relative to the transcriptional start site) of the CaMV 35S promoter was used as a minimal promoter. Expression occurred mainly in the root pericycle, endodermis, and cortex. When the -90/+8 region of the CaMV 35S promoter was fused, the -272/-227 region, which consists of IDE2 and an additional 19 bp, could drive Fe-deficiency-inducible expression without IDE1 throughout almost the entire root. The principal modules of IDE1 and IDE2 were homologous. Sequences homologous to IDE1 were also found in many other Fe-deficiency-inducible promoters, including: nicotianamine aminotransferase (HvNAAT)-A, HvNAAT-B, nicotianamine synthase (HvNAS1), HvIDS3, OsNAS1, OsNAS2, OsIRT1, AtIRT1, and AtFRO2, suggesting the conservation of cis-acting elements in various genes and species. The identification of novel cis-acting elements, IDE1 and IDE2, will provide powerful tools to clarify the molecular mechanisms regulating Fe homeostasis in higher plants.
...
PMID:Identification of novel cis-acting elements, IDE1 and IDE2, of the barley IDS2 gene promoter conferring iron-deficiency-inducible, root-specific expression in heterogeneous tobacco plants. 1467 44

Arabidopsis (Arabidopsis thaliana) and tomato (Lycopersicon esculentum) show similar physiological responses to iron deficiency, suggesting that homologous genes are involved. Essential gene functions are generally considered to be carried out by orthologs that have remained conserved in sequence and map position in evolutionarily related species. This assumption has not yet been proven for plant genomes that underwent large genome rearrangements. We addressed this question in an attempt to deduce functional gene pairs for iron reduction, iron transport, and iron regulation between Arabidopsis and tomato. Iron uptake processes are essential for plant growth. We investigated iron uptake gene pairs from tomato and Arabidopsis, namely sequence, conserved gene content of the regions containing iron uptake homologs based on conserved orthologous set marker analysis, gene expression patterns, and, in two cases, genetic data. Compared to tomato, the Arabidopsis genome revealed more and larger gene families coding for the iron uptake functions. The number of possible homologous pairs was reduced if functional expression data were taken into account in addition to sequence and map position. We predict novel homologous as well as partially redundant functions of ferric reductase-like and iron-regulated transporter-like genes in Arabidopsis and tomato. Arabidopsis nicotianamine synthase genes encode a partially redundant family. In this study, Arabidopsis gene redundancy generally reflected the presumed genome duplication structure. In some cases, statistical analysis of conserved gene regions between tomato and Arabidopsis suggested a common evolutionary origin. Although involvement of conserved genes in iron uptake was found, these essential genes seem to be of paralogous rather than orthologous origin in tomato and Arabidopsis.
...
PMID:Analysis of sequence, map position, and gene expression reveals conserved essential genes for iron uptake in Arabidopsis and tomato. 1553 8

Nicotianamine and nicotianamine synthase (NAS) play key roles in iron nutrition in all higher plants. However, the mechanism underlying the regulation of NAS expression differs among plant species. Sequences homologous to iron deficiency-responsive elements (IDEs), i.e., cis-acting elements, are found on the promoters of these genes. We aimed to verify the interspecies compatibility of the Fe-deficiency response of NAS1 genes and understand the universal mechanisms that regulate their expression patterns in higher plants. Therefore, we introduced the graminaceous (Hordeum vulgare L. and Oryza sativa L.) NAS1 promoter::GUS into dicots (Nicotiana tabacum L. and Arabidopsis thaliana L.). Fe deficiency induced HvNAS1 expression in the shoots and roots when introduced into rice. HvNAS1 promoter::GUS and OsNAS1 promoter::GUS induced strong expression of GUS under Fe-deficient conditions in transformed tobacco. In contrast, these promoters only definitely functioned in Arabidopsis transformants. These results suggest that some Fe nutrition-related trans-factors are not compatible between graminaceous plants and Arabidopsis. HvNAS1 promoter::GUS induced GUS activity only in the roots of transformed tobacco under Fe-deficient conditions. On the other hand, OsNAS1 promoter::GUS induced GUS activity in both the roots and shoots of transformed tobacco under conditions of Fe deficiency. In tobacco transformants, the induction of GUS activity was induced earlier in the shoots than roots. These results suggest that the HvNAS1 and OsNAS1 promoters are compatible with Fe-acquisition-related trans-factors in the roots of tobacco and that the OsNAS1 promoter is also compatible with some shoot-specific Fe deficiency-related trans-factors in tobacco.
...
PMID:Interspecies compatibility of NAS1 gene promoters. 1752 56

Because micronutrients in human diets ultimately come from plant sources, malnutrition of essential minerals is a significant public health concern. By increasing the expression of nicotianamine synthase (NAS), we fortified the level of bioavailable iron in rice seeds. Activation of iron deficiency-inducible OsNAS2 resulted in a rise in Fe content (3.0-fold) in mature seeds. Its ectopic expression also increased that content. Enhanced expression led to higher tolerance of Fe deficiency and better growth under elevated pH. Mice fed with OsNAS2-D1 seeds recovered more rapidly from anemia, indicating that bioavailable Fe contents were improved by this increase in OsNAS2 expression.
...
PMID:Activation of Rice nicotianamine synthase 2 (OsNAS2) enhances iron availability for biofortification. 2222 85

Iron deficiency is a serious problem around the world, especially in developing countries. The production of iron-biofortified rice will help ameliorate this problem. Previously, expression of the iron storage protein, ferritin, in rice using an endosperm-specific promoter resulted in a two-fold increase in iron concentration in the resultant transgenic seeds. However, further over expression of ferritin did not produce an additional increase in the seed iron concentration, and symptoms of iron deficiency were noted in the leaves of the transgenic plants. In the present study, we aimed to further increase the iron concentration in rice seeds without increasing the sensitivity to iron deficiency by enhancing the uptake and transport of iron via a ferric iron chelator, mugineic acid. To this end, we introduced the soybean ferritin gene (SoyferH2) driven by two endosperm-specific promoters, along with the barley nicotianamine synthase gene (HvNAS1), two nicotianamine aminotransferase genes (HvNAAT-A and -B), and a mugineic acid synthase gene (IDS3) to enhance mugineic acid production in rice plants. A marker-free vector was utilized as a means of increasing public acceptance. Representative lines were selected from 102 transformants based on the iron concentration in polished seeds and ferritin accumulation in the seeds. These lines were grown in both commercially supplied soil (iron-sufficient conditions) and calcareous soil (iron-deficient conditions). Lines expressing both ferritin and mugineic acid biosynthetic genes showed signs of iron-deficiency tolerance in calcareous soil. The iron concentration in polished T3 seeds was increased by 4 and 2.5 times, as compared to that in non-transgenic lines grown in normal and calcareous soil, respectively. These results indicate that the concomitant introduction of the ferritin gene and mugineic acid biosynthetic genes effectively increased the seed iron level without causing iron sensitivity under iron-limited conditions.
...
PMID:Iron-biofortification in rice by the introduction of three barley genes participated in mugineic acid biosynthesis with soybean ferritin gene. 2367 79

Nearly one-third of the world population, mostly women and children, suffer from iron malnutrition and its consequences, such as anemia or impaired mental development. Biofortification of rice, which is a staple crop for nearly half of the world's population, can significantly contribute in alleviating iron deficiency. NFP rice (transgenic rice expressing nicotianamine synthase, ferritin and phytase genes) has a more than six-fold increase in iron content in polished rice grains, resulting from the synergistic action of nicotianamine synthase (NAS) and ferritin transgenes. We investigated iron homeostasis in NFP plants by analyzing the expression of 28 endogenous rice genes known to be involved in the homeostasis of iron and other metals, in iron-deficient and iron-sufficient conditions. RNA was collected from different tissues (roots, flag leaves, grains) and at three developmental stages during grain filling. NFP plants showed increased sensitivity to iron-deficiency conditions and changes in the expression of endogenous genes involved in nicotianamine (NA) metabolism, in comparison to their non-transgenic siblings (NTS). Elevated transcript levels were detected in NFP plants for several iron transporters. In contrast, expression of OsYSL2, which encodes a member of yellow stripe like protein family, and a transporter of the NA-Fe(II) complex was reduced in NFP plants under low iron conditions, indicating that expression of OsYSL2 is regulated by the endogenous iron status. Expression of the transgenes did not significantly affect overall iron homeostasis in NFP plants, which establishes the engineered push-pull mechanism as a suitable strategy to increase rice endosperm iron content.
...
PMID:Nicotianamine synthase overexpression positively modulates iron homeostasis-related genes in high iron rice. 2375 54

The nicotianamine synthase (NAS) enzymes catalyze the formation of nicotianamine (NA), a non-proteinogenic amino acid involved in iron homeostasis. We undertook the functional characterization of AtNAS4, the fourth member of the Arabidopsis thaliana NAS gene family. A mutant carrying a T-DNA insertion in AtNAS4 (atnas4), as well as lines overexpressing AtNAS4 both in the atnas4 and the wild-type genetic backgrounds, were used to decipher the role of AtNAS4 in NA synthesis, iron homeostasis and the plant response to iron deficiency or cadmium supply. We showed that AtNAS4 is an important source for NA. Whereas atnas4 had normal growth in iron-sufficient medium, it displayed a reduced accumulation of ferritins and exhibited a hypersensitivity to iron deficiency. This phenotype was rescued in the complemented lines. Under iron deficiency, atnas4 displayed a lower expression of the iron uptake-related genes IRT1 and FRO2 as well as a reduced ferric reductase activity. Atnas4 plants also showed an enhanced sensitivity to cadmium while the transgenic plants overexpressing AtNAS4 were more tolerant. Collectively, our data, together with recent studies, support the hypothesis that AtNAS4 displays an important role in iron distribution and is required for proper response to iron deficiency and to cadmium supply.
...
PMID:Arabidopsis thaliana nicotianamine synthase 4 is required for proper response to iron deficiency and to cadmium exposure. 2375 98

Iron is essential for photosynthesis and is often a limiting nutrient for plant productivity. Plants respond to conditions of iron deficiency by increasing transcript abundance of key genes involved in iron homeostasis, but only a few regulators of these genes have been identified. Using genome-wide expression analysis, we searched for transcription factors that are induced within 24 hours after transferring plants to iron-deficient growth conditions. Out of nearly 100 transcription factors shown to be up-regulated, we identified MYB10 and MYB72 as the most highly induced transcription factors. Here, we show that MYB10 and MYB72 are functionally redundant and are required for plant survival in alkaline soil where iron availability is greatly restricted. myb10myb72 double mutants fail to induce transcript accumulation of the nicotianamine synthase gene NAS4. Both myb10myb72 mutants and nas4-1 mutants have reduced iron concentrations, chlorophyll levels, and shoot mass under iron-limiting conditions, indicating that these genes are essential for proper plant growth. The double myb10myb72 mutant also showed nickel and zinc sensitivity, similar to the nas4 mutant. Ectopic expression of NAS4 rescues myb10myb72 plants, suggesting that loss of NAS4 is the primary defect in these plants and emphasizes the importance of nicotianamine, an iron chelator, in iron homeostasis. Overall, our results provide evidence that MYB10 and MYB72 act early in the iron-deficiency regulatory cascade to drive gene expression of NAS4 and are essential for plant survival under iron deficiency.
...
PMID:MYB10 and MYB72 are required for growth under iron-limiting conditions. 2427 34

Iron deficiency chlorosis (IDC) is a yield limiting problem in soybean (Glycine max (L.) Merr) production regions with calcareous soils. Genome-wide association study (GWAS) was performed using a high density SNP map to discover significant markers, QTL and candidate genes associated with IDC trait variation. A stepwise regression model included eight markers after considering LD between markers, and identified seven major effect QTL on seven chromosomes. Twelve candidate genes known to be associated with iron metabolism mapped near these QTL supporting the polygenic nature of IDC. A non-synonymous substitution with the highest significance in a major QTL region suggests soybean orthologs of FRE1 on Gm03 is a major gene responsible for trait variation. NAS3, a gene that encodes the enzyme nicotianamine synthase which synthesizes the iron chelator nicotianamine also maps to the same QTL region. Disease resistant genes also map to the major QTL, supporting the hypothesis that pathogens compete with the plant for Fe and increase iron deficiency. The markers and the allelic combinations identified here can be further used for marker assisted selection.
...
PMID:Genome-wide association studies identifies seven major regions responsible for iron deficiency chlorosis in soybean (Glycine max). 2522 93


1 2 Next >>