Gene/Protein Disease Symptom Drug Enzyme Compound
Pivot Concepts:   Target Concepts:
Query: UMLS:C0240066 (iron deficiency)
 7,156 document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)

A cDNA clone, Ids3 (iron deficiency-specific clone 3), was isolated from an Fe-deficient-root cDNA library of Hordeum vulgare. Ids3 encodes a protein of 339 amino acids with a calculated molecular mass of 37.7 kDa, and its amino acid sequence shows a high degree of similarity with those of plant and fungal 2-oxoglutarate-dependent dioxygenases. One aspartate and two histidine residues for ferrous Fe binding (Asp-211, His-209, His-265) and arginine and serine residues for 2-oxoglutarate binding (Arg-275, Ser-277) are conserved in the predicted amino acid sequence of Ids3. Ids3 expression was rapidly induced by Fe deficiency, and was suppressed by re-supply of Fe. Among eight graminaceous species tested, Ids3 expression was observed only in Fe-deficient roots of H. vulgare and Secale cereale. which not only secrete 2'-deoxymugineic acid (DMA), but also mugineic acid (MA) and 3-epihydroxymugineic acid (epiHMA, H. vulgare), and 3-hydroxymugineic acid (HMA, S. cereale). The Ids3 gene is encoded on the long arm of chromosome 4H of H. vulgare, which also carries the hydroxylase gene that converts DMA to MA. Moreover, the Ids2 gene, which is the plant dioxygenase with the highest homology to Ids3, is encoded on the long arm of chromosome 7H of H. vulgate, which carries the hydroxylase gene that converts MA to epiHMA. The observed expression patterns of the Ids3 and Ids2 genes strongly suggest that IDS3 is an enzyme that hydroxylates the C-2' positions of DMA and epiHDMA, while IDS2 hydroxylates the C-3 positions of MA and DMA.
 ...
PMID:Two dioxygenase genes, Ids3 and Ids2, from Hordeum vulgare are involved in the biosynthesis of mugineic acid family phytosiderophores. 1111 63

The molecular mechanisms of plant responses to iron (Fe) deficiency remain largely unknown. To identify the cis-acting elements responsible for Fe-deficiency-inducible expression in higher plants, the barley IDS2 (iron deficiency specific clone no. 2) gene promoter was analyzed using a transgenic tobacco system. Deletion analysis revealed that the sequence between -272 and -91 from the translational start site (-272/-91) was both sufficient and necessary for specific expression in tobacco roots. Further deletion and linker-scanning analysis of this region clearly identified two cis-acting elements: iron-deficiency-responsive element 1 (IDE1) at -153/-136 (ATCAAGCATGCTTCTTGC) and IDE2 at -262/-236 (TTGAACGGCAAGTTTCACGCTGTCACT). The co-existence of IDE1 and IDE2 was essential for specific expression when the -46/+8 region (relative to the transcriptional start site) of the CaMV 35S promoter was used as a minimal promoter. Expression occurred mainly in the root pericycle, endodermis, and cortex. When the -90/+8 region of the CaMV 35S promoter was fused, the -272/-227 region, which consists of IDE2 and an additional 19 bp, could drive Fe-deficiency-inducible expression without IDE1 throughout almost the entire root. The principal modules of IDE1 and IDE2 were homologous. Sequences homologous to IDE1 were also found in many other Fe-deficiency-inducible promoters, including: nicotianamine aminotransferase (HvNAAT)-A, HvNAAT-B, nicotianamine synthase (HvNAS1), HvIDS3, OsNAS1, OsNAS2, OsIRT1, AtIRT1, and AtFRO2, suggesting the conservation of cis-acting elements in various genes and species. The identification of novel cis-acting elements, IDE1 and IDE2, will provide powerful tools to clarify the molecular mechanisms regulating Fe homeostasis in higher plants.
 ...
PMID:Identification of novel cis-acting elements, IDE1 and IDE2, of the barley IDS2 gene promoter conferring iron-deficiency-inducible, root-specific expression in heterogeneous tobacco plants. 1467 44

Under conditions of iron deficiency, graminaceous plants induce the expression of genes involved in the biosynthesis of mugineic acid family phytosiderophores. We previously identified the novel cis-acting elements IDE1 and IDE2 (iron-deficiency-responsive element 1 and 2) through promoter analysis of the barley (Hordeum vulgare L.) iron-deficiency-inducible IDS2 gene in tobacco (Nicotiana tabacum L.). To gain further insight into plant gene regulation under iron deficiency, we analyzed the barley iron-deficiency-inducible IDS3 gene, which encodes mugineic acid synthase. IDS3 promoter fragments were fused to the beta-glucuronidase (GUS) gene, and this construct was introduced into Arabidopsis thaliana L. and tobacco plants. In both Arabidopsis and tobacco, GUS activity driven by the IDS3 promoter showed strongly iron-deficiency-inducible and root-specific expression. Expression occurred mainly in the epidermis of Arabidopsis roots, whereas expression was dominant in the pericycle, endodermis, and cortex of tobacco roots, resembling the expression pattern conferred by IDE1 and IDE2. Deletion analysis revealed that a sequence within -305 nucleotides from the translation start site was sufficient for specific expression in both Arabidopsis and tobacco roots. Gain-of-function analysis revealed functional regions at -305/-169 and -168/-93, whose coexistence was required for the induction activity in Arabidopsis roots. Multiple IDE-like sequences were distributed in the IDS3 promoter and were especially abundant within the functional region at -305/-169. A sequence moderately homologous to that of IDE1 was also present within the -168/-93 region. These IDE-like sequences would be the first candidates for the functional iron-deficiency-responsive elements in the IDS3 promoter.
 ...
PMID:Promoter analysis of iron-deficiency-inducible barley IDS3 gene in Arabidopsis and tobacco plants. 1746 82