Gene/Protein Disease Symptom Drug Enzyme Compound
Pivot Concepts:   Target Concepts:
Query: UMLS:C0240066 (iron deficiency)
 7,156 document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)

The molecular mechanisms of plant responses to iron (Fe) deficiency remain largely unknown. To identify the cis-acting elements responsible for Fe-deficiency-inducible expression in higher plants, the barley IDS2 (iron deficiency specific clone no. 2) gene promoter was analyzed using a transgenic tobacco system. Deletion analysis revealed that the sequence between -272 and -91 from the translational start site (-272/-91) was both sufficient and necessary for specific expression in tobacco roots. Further deletion and linker-scanning analysis of this region clearly identified two cis-acting elements: iron-deficiency-responsive element 1 (IDE1) at -153/-136 (ATCAAGCATGCTTCTTGC) and IDE2 at -262/-236 (TTGAACGGCAAGTTTCACGCTGTCACT). The co-existence of IDE1 and IDE2 was essential for specific expression when the -46/+8 region (relative to the transcriptional start site) of the CaMV 35S promoter was used as a minimal promoter. Expression occurred mainly in the root pericycle, endodermis, and cortex. When the -90/+8 region of the CaMV 35S promoter was fused, the -272/-227 region, which consists of IDE2 and an additional 19 bp, could drive Fe-deficiency-inducible expression without IDE1 throughout almost the entire root. The principal modules of IDE1 and IDE2 were homologous. Sequences homologous to IDE1 were also found in many other Fe-deficiency-inducible promoters, including: nicotianamine aminotransferase (HvNAAT)-A, HvNAAT-B, nicotianamine synthase (HvNAS1), HvIDS3, OsNAS1, OsNAS2, OsIRT1, AtIRT1, and AtFRO2, suggesting the conservation of cis-acting elements in various genes and species. The identification of novel cis-acting elements, IDE1 and IDE2, will provide powerful tools to clarify the molecular mechanisms regulating Fe homeostasis in higher plants.
 ...
PMID:Identification of novel cis-acting elements, IDE1 and IDE2, of the barley IDS2 gene promoter conferring iron-deficiency-inducible, root-specific expression in heterogeneous tobacco plants. 1467 44

Under conditions of iron deficiency, graminaceous plants induce the expression of genes involved in the biosynthesis of mugineic acid family phytosiderophores. We previously identified the novel cis-acting elements IDE1 and IDE2 (iron-deficiency-responsive element 1 and 2) through promoter analysis of the barley (Hordeum vulgare L.) iron-deficiency-inducible IDS2 gene in tobacco (Nicotiana tabacum L.). To gain further insight into plant gene regulation under iron deficiency, we analyzed the barley iron-deficiency-inducible IDS3 gene, which encodes mugineic acid synthase. IDS3 promoter fragments were fused to the beta-glucuronidase (GUS) gene, and this construct was introduced into Arabidopsis thaliana L. and tobacco plants. In both Arabidopsis and tobacco, GUS activity driven by the IDS3 promoter showed strongly iron-deficiency-inducible and root-specific expression. Expression occurred mainly in the epidermis of Arabidopsis roots, whereas expression was dominant in the pericycle, endodermis, and cortex of tobacco roots, resembling the expression pattern conferred by IDE1 and IDE2. Deletion analysis revealed that a sequence within -305 nucleotides from the translation start site was sufficient for specific expression in both Arabidopsis and tobacco roots. Gain-of-function analysis revealed functional regions at -305/-169 and -168/-93, whose coexistence was required for the induction activity in Arabidopsis roots. Multiple IDE-like sequences were distributed in the IDS3 promoter and were especially abundant within the functional region at -305/-169. A sequence moderately homologous to that of IDE1 was also present within the -168/-93 region. These IDE-like sequences would be the first candidates for the functional iron-deficiency-responsive elements in the IDS3 promoter.
 ...
PMID:Promoter analysis of iron-deficiency-inducible barley IDS3 gene in Arabidopsis and tobacco plants. 1746 82

Iron is a trace element important for the proper folding and function of various proteins. Physiological regulation of iron stores is of critical importance for RBC production and antimicrobial defense. Hepcidin is a key regulator of iron levels within the body. Under conditions of iron deficiency, hepcidin expression is reduced to promote increased iron uptake from the diet and release from cells, whereas during conditions of iron excess, induction of hepcidin restricts iron uptake and movement within the body. The cytokine IL-6 is well established as an important inducer of hepcidin. The presence of this cytokine during inflammatory states can induce hepcidin production, iron deficiency, and anemia. In this study, we show that IL-22 also influences hepcidin production in vivo. Injection of mice with exogenous mouse IgG1 Fc fused to the N terminus of mouse IL-22 (Fc-IL-22), an IL-22R agonist with prolonged and enhanced functional potency, induced hepcidin production, with a subsequent decrease in circulating serum iron and hemoglobin levels and a concomitant increase in iron accumulation within the spleen. This response was independent of IL-6 and was attenuated in the absence of the IL-22R-associated signaling kinase, Tyk2. Ab-mediated blockade of hepcidin partially reversed the effects on iron biology caused by IL-22R stimulation. Taken together, these data suggest that exogenous IL-22 regulates hepcidin production to physiologically influence iron usage.
 ...
PMID:IL-22 regulates iron availability in vivo through the induction of hepcidin. 2383 59

Iron is an indispensable micronutrient for plant growth and development. Limited bioavailability of Fe in the soil leads to iron deficiency chlorosis in plants and yield loss. In this study, two soybean basic helix-loop-helix transcription factors, GmbHLH57 and GmbHLH300, were identified in response to Fe-deficiency. Both transcription factors are expressed in roots and nodules, and are induced by Fe deficiency; these patterns were confirmed in transgenic hairy roots expressing constructs of the endogenous promoters fused to a GUS reporter gene. Bimolecular fluorescence complementation, yeast two-hybrid and coimmunoprecipitation (co-IP) assays indicated a physical interaction between GmbHLH57 and GmbHLH300. Studies on transgenic soybeans overexpressing GmbHLH57 and GmbHLH300 revealed that overexpression of each transcription factor, alone, results in no change of the responses to Fe deficiency, whereas overexpression of both transcription factors upregulated the downstream Fe uptake genes and increased the Fe content in these transgenic plants. Compared to wild type, these double overexpression transgenic plants were more tolerant to Fe deficiency. Taken together, our findings establish that GmbHLH57 and GmbHLH300 are important transcription factors involved in Fe homeostasis in soybean.
 ...
PMID:Two soybean bHLH factors regulate response to iron deficiency. 2957 45