Gene/Protein Disease Symptom Drug Enzyme Compound
Pivot Concepts:   Target Concepts:
Query: UMLS:C0038362 (stomatitis)
 8,852 document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)

A T particle of vesicular stomatitis virus, containing most of the L-gene region, has been isolated. In vitro, these T particles synthesize exclusively a small adenine-rich RNA that is complementary to the T-particle genome. Partial sequence analysis of this small RNA indicates that it is an RNA of unique sequence with a length of approximately 45 nucleotides.
J Virol 1977 Sep
PMID:In vitro synthesis of a unique RNA species by a T particle of vesicular stomatitis virus. 19 68

The ribosome recognition sites from vesicular stomatitis virus mRNAs have been isolated by ribosome protection of the mixture of viral mRNAs followed by complete separation of the protected sites by two-dimensional gel electrophoresis. The sites from the four major mRNAs each contain a single AUG initiation codon, indicating that they are true initiation sites, and the complete sequences of the N, NS, and G mRNA sites are reported. The sites do not all share common features nor do they have significant regions complementary to the known sequence at the 3'-terminus of 18S rRNA. The N and NS mRNAs show anine-nucleotide homology in the first eleven nucleotides extending from the capped 5'-end.
Proc Natl Acad Sci U S A 1977 Sep
PMID:Nucleotide sequences of ribosome recgonition sites in messenger RNAs of vesicular stomatitis virus. 19 95

The 2S RNA synthesized in vitro by the RNA polymerase of a defective interfering (DI) particle of vesicular stomatitis virus was labeled at its 3' terminus with 32P-cytidine 3', 5' bisphosphate and RNA ligase. Analysis of the labeled RNA showed that it was a family of RNAs of different length but all sharing the same 5' terminal sequence. The largest labeled RNA was purified by gel electrophoresis, and the sequence of 41 of its 46 nucleotides was determined by rapid RNA sequencing methods. The assignment of the remaining 5 nucleotides was made on the basis of an analysis of one of the smaller RNAs and published data. A new approach in RNA sequencing based on the identification of 3' terminal nucleotides of rna fragments originally present in the DI product or generated during the ligation reaction confirmed most of the sequence. The complete sequence of this 46 nucleotide long plus-sense RNA is: ppACGAAGACCACAAAACCAGAUAAAAAA UAAAAACCACAAGAGGGUC-OH. This RNA anneals to the RNA of the DI particle from which it was synthesized, indicating that its synthesis is template-specified. At least the first 17 and possibly all of the nucleotides are also complementary to sequences at the 3' end of two other VSV DI particles which were derived independently and whose genomes differ significantly in length. These data suggest a common 3' terminal sequence among all VSV DI particles which contain part of the Lgene region of the parental genome.
Cell 1978 Sep
PMID:The complete sequence of a unique RNA species synthesized by a DI particle of VSV. 21 97

The complete nucleotide sequence of the leader RNA synthesized in vitro by the Indiana serotype of vesicular stomatitis virus is presented. The sequence was determined by the technique described by Donis-Keller, Maxam and Gilbert (1977) in combination with the standard two-dimensional fingerprint techniques described by Barrell (1971). The leader RNA contains 48 nucleotides variably terminating at the 3' terminus with cytosine (68%) and adenosine at position 47 (32%). Since the leader RNA is complementary to the 3' terminal portion of the viral genome RNA, the first 48 nucleotides from the 3' end of the genome RNA can be decuded. The leader RNA contains repetitive and palindromic sequences with a polypurine sequence at its 3' terminus. The possible role of some of the sequences is discussed.
Cell 1978 Sep
PMID:Complete nucleotide sequence of the leader RNA synthesized in vitro by vesicular stomatitis virus. 21 1

The L and NS proteins of vesicular stomatitis virions (New Jersey serotype) were solubilized with Triton X-100 and high-salt buffer and recombined with purified nucleocapsids under conditions similar to those used to reconstitute transcriptase activity in vitro. The nucleocapsid-bound L and NS proteins were separated from unbound proteins on a glycerol gradient. The rebinding of L and NS proteins mimics the in vivo binding in that at saturation the ratio of L and NS molecules to N molecules is approximately the same as observed in the intact virion. L and NS proteins were separated and added back independently and in combination to the template. The purified NS protein bound to the template in the absence of L protein. However, the L protein binding appeared to depend on the presence of NS protein. The presence of Mg2+ and nucleotides, which is required for transcription, was not necessary for the rebinding of L and NS proteins.
J Virol 1978 Sep
PMID:Rebinding of transcriptase components (L and NS proteins) to the nucleocapsid template of vesicular stomatitis virus. 21 81

Inhibitors of elongation steps in protein synthesis such as cycloheximide and anisomycin mimic interferon treatment in that they specifically inhibit the synthesis of certain viral proteins. These specific effects are seen only at very low concentrations of the antibiotics, under conditions where host cellular protein synthesis, as well as cell viability, are not severely reduced. A qualitatively as well as quantitatively close correlation between the effects of the two types of agents has been established for encephalomyocarditis virus, vesicular stomatitis virus and murine leukemia virus protein synthesis. It is concluded that one of the primary mechanisms of interferon action may be a nonspecific retardation of one or more elongation steps, and that this may be sufficient to account for its effects on the replication of certain viruses such as encephalomyocarditis and vesicular stomatitis viruses.
J Virol 1978 Sep
PMID:Specificity of interferon action in protein synthesis. 21 87

Purified cores of vesicular stomatitis virus contain an enzymatic activity that converts GDP, UDP, and CDP into their corresponding triphosphates using ATP as the phosphate donor. Thus, the virion-associated RNA polymerase can synthesize mRNA normally in vitro even when one of the ribonucleoside triphosphates is replaced by its corresponding diphosphate. RNA synthesis does not proceed if ATP is replaced by ADP. Similarly RNA synthesis is impaired if CDP and UDP are present in the same reaction. The role of the nucleoside diphosphate kinase (NDP kinase, EC 2.7.4.6) in vesicular stomatitis virus mRNA synthesis in vitro is discussed.
J Biol Chem 1979 Sep 25
PMID:Nucleoside diphosphate kinase activity in purified cores of vesicular stomatitis virus. 22 22

Hep-2 cells infected with measles virus (MV) for as short as 6 h became refractory to superinfection with canine distemper virus (CDV) but not to vesicular stomatitis virus (VSV). The exact mechanism of such interference is unknown but probably occurs after virus attachment and penetration. These results verify the suggestion that virus interference may be a mechanism of heterotypic protection against canine distemper.
Experientia 1979 Sep 15
PMID:Mechanisms of heterotypic immunity against canine distemper. 22 95

We have studied the co-redistribution of vesicular stomatitis virus (VSV) antigen and of individual H-2 antigens on the surfaces of mouse cells, and in parallel we have also used these VSV-infected cells as targets in cytotoxic T-cell killing experiments. Antibody-induced patching and capping of the VSV antigen caused an extensive co-patching and co-capping of the H-2Kb antigen but not of the H-2Db antigen. In reciprocal experiments, the antibody-induced patching of the H-2Kb or H-2Db antigen did not result in a co-patching of the VSV antigen. Radioimmunoassays showed that the relative numbers of H-2Kb, H-2Db, and VSV antigens on the surfaces of the cells exhibiting such nonreciprocal co-redistributions were closely similar. Furthermore, the H-2 restricted cytotoxic T-cell lysis of these target cells showed a marked preference for H-2Kb compared to H-2Db compatibility. We propose that the VSV and H-2 antigens are molecularly independent entities in the unpreturbed target cell membrane but that the antibody-induced clustering of the VSV antigen causes a selective and unidirectional co-redistribution (which we designate as syn-capping) of H-2Kb with the VSV antigen clusters. It is suggested that such a T-cell-induced syn-capping process involving an antigen and an H-2 molecule on the target cell may play a critical role in the mechanism of cytotoxic T-cell killing.
Proc Natl Acad Sci U S A 1979 Sep
PMID:Selective and unidirectional membrane redistribution of an H-2 antigen with an antibody-clustered viral antigen: relationship to mechanisms of cytotoxic T-cell interactions. 22 3

Thirty-nine adults with acute leukaemia who had relapsed when receiving extensive chemotherapy were treated with a combination of methotrexate and colaspase (L-asparaginase) given sequentially. Patients initially received 50-80 mg/m(2) methotrexate, followed three hours later by intravenous colaspase, 40 000 IU/m(2). Seven days later intravenous methotrexate, 120 mg/m(2) was given. Each dose of methotrexate was followed 24 hours later by colaspase, and the two-day course of treatment was repeated every 7-14 days. The methotrexate dose was increased to tolerance by increments of 40 mg/m(2) with each course, while the colaspase dose remained constant unless abnormal liver function developed, when it was reduced by half.Overall, 18 out of 39 patients achieved complete remission (46%). Of these, 13 out of 21 (62%) had acute lymphoblastic leukaemia, three out of seven (43%) acute undifferentiated leukaemia, and two out of 11 (18%) acute myeloblastic leukaemia. The median duration of complete remission was 20 weeks and the median duration of survival in complete responders was 45 weeks. The median number of courses needed to achieve complete remission was three. The maximum tolerated dose of methotrexate was 400 mg/m(2) (median 200 mg/m(2)). Major side effects were due to colaspase. Methotrexate in doses of up to 400 mg/m(2) caused minimal myelosuppression and stomatitis, which suggested that colaspase given sequentially provides relative protection from methotrexate toxicity without the need for folinic acid (citrovorum factor) rescue.The combination of sequential colaspase and methotrexate is highly effective in reinducing remission in patients with acute lymphoblastic leukaemia or acute undifferentiated leukaemia. The regimen is easy to administer and relatively non-toxic, so it is suitable for use in outpatients, either alone or combined with other agents.
Br Med J 1978 Sep 16
PMID:Refractory acute leukaemia in adults treated with sequential colaspase and high-dose methotrexate. 27 87


<< Previous 1 2 3 4 5 6 7 8 9 10 Next >>