Gene/Protein Disease Symptom Drug Enzyme Compound
Pivot Concepts:   Target Concepts:
Query: UMLS:C0036572 (seizures)
 80,221 document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)

Macrophagic myofasciitis has been almost exclusively detected in adults only. We describe six children of Arab Moslem origin with this disorder. Three presented with hypotonia, developmental delay and seizures and were evaluated for a mitochondrial disorder. The other three children had hypotonia and predominantly motor delay. Five of the six families were consanguineous. A massive collection of macrophages was present in the fascia and adjacent epimysium in all biopsies. The macrophages were periodic-acid-Schiff positive and immunoreactive for CD68. One biopsy which was evaluated by electron microscopy and energy-dispersive X-ray microanalysis showed crystalline structures containing aluminum in macrophages. Two children with motor delay and hypotonia were treated with oral prednisone for 3 months with no clinical improvement. Genetic predisposition probably accounts for the variability in the prevalence of macrophagic myofasciitis in different populations. At least in childhood, there seems to be no connection between macrophagic myofasciitis as a pathological entity and the clinical symptoms and signs.
 ...
PMID:Childhood macrophagic myofasciitis-consanguinity and clinicopathological features. 1501 2

We report a case of a pregnant woman with a mitochondrial disorder affecting the energy-generating pathway of oxidative phosphorylation which was suggested when the patient presented the progressive clinical phenotype of a proximal tubular renal insufficiency, a muscular weakness of extremities, a bilateral optic neuropathy and a brain magnetic resonance imaging suggesting diffuse leucoencephalopathy. Her diagnosis was made on the basis of abnormal mitochondria on a muscle biopsy and of spectrophotometric deficiencies of the complexes I, II+III and IV of the respiratory chain. No specific molecular mutation could be detected. Her pregnancy was complicated by a severe preeclampsia, an insulin requiring gestational diabetes and a worrying renal failure which precipitated the premature delivery by cesarean section at 30 weeks gestation. The clinical course of the female neonate weighing 1030 grams was uneventful. At two Years of age she showed no sign of mitochondrial disease. But the postpartum course of the mother was complicated by seizures and a terminal renal failure leading presently to dialysis, but requiring a kidney transplantation in the near future.
 ...
PMID:[Pregnancy in a patient with mitochondrial disease]. 1505 79

Molecular diagnosis of mitochondrial DNA disorder is usually focused on point mutations and large deletions. In the absence of detectable mtDNA mutations, abnormal amounts of mtDNA, either depletion or elevation, can be indicative of mitochondrial dysfunction. The amount of mitochondrial DNA (mtDNA), however, varies among individuals of different ages and among different tissues within the same individual. To establish a range of mtDNA levels, we analyzed 300 muscle and 200 blood specimens from patients suspected of having a mitochondrial disorder by real-time quantitative polymerase chain reaction (PCR) method. Copy numbers were calculated from the standard curve and threshold cycle number using TaqMan probes; 6FAM 5'TTACCGGGCTCTGCCATCT3'-TAMRA and VIC-5'AGCAATAACAGGTCTGTGATG3'-TAMRA for mtDNA and 18S rRNA gene (nDNA), respectively. The copy number ratio of mtDNA to nDNA was used as a measure of mtDNA content in each specimen. The mtDNA content in muscle increases steadily from birth to about 5 years of age; thereafter, it stays about the same. On the contrary, the mtDNA content in blood decreases with age. The amount of mtDNA in skeletal muscle is about 5-20 times higher than that in blood. About 7% of patients had mtDNA levels in muscle below 20% of the mean of the age-matched group, and about 10% of patients had muscle mtDNA levels 2- to 16-fold higher than the mean of the age-matched group. Patients with abnormal levels of mtDNA, either depletion or proliferation, had significant clinical manifestations characteristic of mitochondrial disease in addition to abnormal respiratory enzymes and mitochondrial cytopathies. Cardiomyopathy, lactic acidosis, abnormal brain MRI findings, hypotonia, developmental delay, seizures, and failure to thrive are general clinical pictures of patients with mtDNA depletion. The average age of patients with mtDNA depletion is 4.1 years, compared to 23.6 years in patients with mtDNA proliferation. Mutations in nuclear genes involved in mtDNA synthesis and deoxynucleotide pools are probably the cause of mtDNA depletion. Our results demonstrate that real time quantitative PCR is a valuable tool for molecular screening of mitochondrial diseases.
 ...
PMID:Quantitative PCR analysis of mitochondrial DNA content in patients with mitochondrial disease. 1512 6

The Drosophila mutant technical knockout (tko), affecting the mitochondrial protein synthetic apparatus, exhibits respiratory chain deficiency and a phenotype resembling various features of mitochondrial disease in humans (paralytic seizures, deafness, developmental retardation). We are using this mutant to analyse the cellular and genomic targets of mitochondrial dysfunction, and to identify ways in which the phenotype can be alleviated. Transgenic expression of wild-type tko in different patterns in the mutant background reveals critical times and cell-types for production of components of the mitochondrial disease-like phenotype. Mitochondrial bioenergy deficit during the period of maximal growth, as well as in specific parts of the nervous system, appears to be most deleterious. Inbreeding of tko mutant lines results in a systematic improvement in all phenotypic parameters tested. The resulting sub-lines can be used for genetic mapping and transcriptomic analysis, revealing clues as to the genes and pathways that can modify mitochondrial disease-like phenotypes in a model metazoan.
 ...
PMID:Mitochondrial disease in flies. 1557 51

We describe a 20-year-old 46,XY woman, with clinical findings of Fraser syndrome and three mitochondrial DNA (mtDNA) mutations of Leber hereditary optic neuropathy. The patient had microphthalmia, blindness, widely spaced nipples, bifid ureter, syndactyly of the toes, and mental retardation. Sonography showed the presence of a uterus and intra-abdominal gonads. The proband was screened for mtDNA mutations because of chronic gastrointestinal pseudo-obstruction, urinary tract dysmotility, seizures, mental retardation and persistent macrocytosis, as well as the intermittent elevation of methylmalonic acid. Analysis of point mutations by multiplex polymerase chain reaction and allele-specific oligonucleotide dot-blot hybridization revealed three homoplasmic mtDNA mutations, T14484C, T4216C, and T3394C. This represents a unique case with sex reversal, Fraser-like syndrome, and mitochondrial disease.
 ...
PMID:Mitochondrial DNA mutations in a patient with sex reversal and clinical features consistent with Fraser syndrome. 1569 63

We report two children with focal segmental glomerulosclerosis (FSGS) associated with mitochondrial cytopathy (MC). Case 1 was diagnosed as MC with the findings of ptosis, ophthalmoplegia, failure to thrive, high serum lactate and pyruvate levels, ragged red fibers in muscle biopsy and the common 4.9 kb deletion in mtDNA when she was four years old. She subsequently developed FSGS four years later. Case 2 was a four month-old girl presenting with feeding difficulty from birth, with vomiting, seizures and nystagmoid eye movements, nephrotic proteinuria and hematuria. Renal biopsy revealed FSGS. Ultrastructural study demonstrated markedly pleomorphic mitochondria in podocytes with a severe effacement of foot processes. The analyses of muscle biopsy and skin fibroblasts for respiratory chain enzymes were found to be normal, while mitochondrial DNA analysis revealed the population of a single deleted mtDNA in the heteroplasmic state. The present cases illustrate FSGS as a rare renal complication of mitochondrial disease and provide further evidence of podocytes possessing abnormal mitochondria which may cause glomerular epithelial cell damage leading to glomerulosclerosis.
 ...
PMID:Focal segmental glomerulosclerosis associated with mitochondrial cytopathy: report of two cases with special emphasis on podocytes. 1632 67

Mitochondrial neurogastrointestinal encephalomyopathy is a rare disorder affecting the pediatric age group with a heterogeneous multisystem involvement. We happen to manage a young child with symptoms of constipation since infancy along with cachexia, seizures and peripheral neuropathy. The child later went into encephalopathy preterminally. This clinical syndrome fitted very well with mitochondrial neurogastrointestinal encephalomyopathy. The child had elevated lactate levels and electron microscopy of the rectal biopsy was suggestive of a mitochondrial disorder To the best of our knowledge there is no case report of this syndrome from India and since this presents with diagnostic difficulties so is being reported.
 ...
PMID:Mitochondrial neuro-gastrointestinal encephalopathy syndrome. 1720 42

Epilepsy is one of the most common presentations of patients with mitochondrial myopathy, encephalopathy, lactic acidosis, and stroke-like episodes (MELAS). MELAS is typically caused by an A-to-G substitution at nucleotide position 3243 of mitochondrial DNA. Valproic acid, a common anticonvulsant, can actually increase the frequency of seizures in individuals with MELAS. Here, we report a single case-study of a 38-year-old man who presented with focal seizures and had MELAS Syndrome due to the A3243G mitochondrial DNA mutation. Manifestation of epilepsia partialis continua was aggravated by use of valproic acid. Convulsions abated after discontinuation of valproic acid. Our experience suggests that valproic acid should be avoided for the treatment of epilepsy in individuals with mitochondrial disease.
 ...
PMID:Valproic acid aggravates epilepsy due to MELAS in a patient with an A3243G mutation of mitochondrial DNA. 1722 98

We retrospectively investigated outcome data for vagus nerve stimulation (VNS) in children less than 12 years of age with intractable seizures and mitochondrial disease. Five children with a mitochondrial disease, due to electron transport chain deficiency, were studied. Information was collected from clinic visits prior to, and subsequent to, VNS implantation. Data were collected by type and frequency of seizures, encephalogram and neuroimaging findings, and medication history. Four of the children had predominantly myoclonic seizures, while the other child had focal seizures with secondary generalization and myoclonic seizures. All five children did not have significant reduction in seizure frequency with VNS. VNS may not be an effective method to control myoclonic seizures in children with electron transport chain disorders.
 ...
PMID:Vagus nerve stimulation in children with mitochondrial electron transport chain deficiencies. 1751 78

In this retrospective study, we reviewed the charts and collected clinical and radiographic data on children (age range, 1 month to 18 years) with symptoms and radiographic confirmation of ischemic stroke for the period of January 1996 to July 2006. Ninety-four children were enrolled. Eighty-eight had arterial ischemic stroke and six had sinovenous thrombosis. Twenty-nine percent of the children had seizures. Twenty-six percent had diffuse neurological signs and 76% had focal neurological signs. Risk factors included vascular disease (33%), infection (27%), metabolic disorders (18%), trauma (11%), prothrombotic states (13%), cardiac disease (10%), and mitochondrial disease (6%). Ten percent (n=9) had no identifiable cause. Twenty-two percent of the children had more than one risk factor. Anterior territory (70%) was more involved than posterior territory (18%) in arterial ischemic stroke. Unilateral infarctions were more common on the left side (51%) than on the right (24.5%). Neurological deficits were present in 45% (n=34/75) of the children; the most frequent deficit was motor impairment (24%). Seven children (9%) died in the acute stage. There were 12 children (16%) who had recurrent stroke and 8 children (8/12) who had underlying vascular disease. The vascular disease included moyamoya disease (5), CNS lupus (1) and ill-defined vasculopathy (2). The etiology pattern in Taiwan was different from that in Western countries. Vascular disease was a significant risk factor for recurrence in childhood ischemic stroke.
 ...
PMID:Risk factors and outcomes of childhood ischemic stroke in Taiwan. 1757 20


<< Previous 1 2 3 4 5 6 7 8 9 10 Next >>