Gene/Protein Disease Symptom Drug Enzyme Compound
Pivot Concepts:   Target Concepts:
Query: UMLS:C0034186 (pyelonephritis)
 6,144 document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)

Pyelonephritis-associated pili (Pap) expression in uropathogenic Escherichia coli is regulated by a complex phase variation mechanism involving the competition between leucine-responsive regulatory protein (Lrp) and DNA adenine methylase (Dam). Population dynamics of pap gene expression has been studied extensively and the detailed molecular mechanism has been largely elucidated, providing sufficient information for mathematical modeling. Although the Gillespie algorithm is suited for modeling of stochastic systems such as the pap operon, it becomes computationally expensive when detailed molecular steps are explicitly modeled in a population. Here we developed a Markov Chain model to simplify the computation. Our model is analytically derived from the molecular mechanism. The model presented here is able to reproduce results presented using the Gillespie method, but since the regulatory information is incorporated before simulation, our model runs more efficiently and allows investigation of additional regulatory features. The model predictions are consistent with experimental data obtained in this work and in the literature. The results show that pap expression in uropathogenic E. coli is initial-state-dependent, as previously reported. However, without environment stimuli, the pap-expressing fraction in a population will reach an equilibrium level after approximately 50-100 generations. The transient time before reaching equilibrium is determined by PapI stability and Lrp and Dam copy numbers per cell. This work demonstrates that the Markov Chain model captures the essence of the complex molecular mechanism and greatly simplifies the computation.
 ...
PMID:Markov Chain modeling of pyelonephritis-associated pili expression in uropathogenic Escherichia coli. 1568 43

Pyelonephritis-associated pili (pap) allow uropathogenic Escherichia coli to bind to epithelial cells and play an important role in urinary tract infection. Expression of pap is controlled by a phase-variation mechanism, based on the two distinct heritable states that are the result of adenine N6-methylation in either of the two GATC sequences in its regulatory region. The methylation status of these two sequences is sensed by the action of two proteins, Lrp and PapI, and they play a central role in determining pap gene expression in both phase-ON and phase-OFF cells. We used modern NMR techniques to determine the solution structure and backbone dynamics of PapI. We found its overall fold resembles closely that of the winged helix-turn-helix family of DNA-binding proteins. We determined that PapI possesses its own DNA-binding activity, albeit non-sequence-specific, independent of Lrp. PapI appears to bind to DNA with a K(d) in the 10 microM range. Possible mechanisms by which PapI might participate in the regulation of the pap operon are discussed in light of these new findings.
 ...
PMID:Solution structure of Escherichia coli PapI, a key regulator of the pap pili phase variation. 1710 85

Uropathogenic Escherichia coli (UPEC) strains are responsible for the majority of uncomplicated urinary tract infections, which can present clinically as cystitis or pyelonephritis. UPEC strain CFT073, isolated from the blood of a patient with acute pyelonephritis, was most cytotoxic and most virulent in mice among our strain collection. Based on the genome sequence of CFT073, microarrays were utilized in comparative genomic hybridization (CGH) analysis of a panel of uropathogenic and fecal/commensal E. coli isolates. Genomic DNA from seven UPEC (three pyelonephritis and four cystitis) isolates and three fecal/commensal strains, including K-12 MG1655, was hybridized to the CFT073 microarray. The CFT073 genome contains 5,379 genes; CGH analysis revealed that 2,820 (52.4%) of these genes were common to all 11 E. coli strains, yet only 173 UPEC-specific genes were found by CGH to be present in all UPEC strains but in none of the fecal/commensal strains. When the sequences of three additional sequenced UPEC strains (UTI89, 536, and F11) and a commensal strain (HS) were added to the analysis, 131 genes present in all UPEC strains but in no fecal/commensal strains were identified. Seven previously unrecognized genomic islands (>30 kb) were delineated by CGH in addition to the three known pathogenicity islands. These genomic islands comprise 672 kb of the 5,231-kb (12.8%) genome, demonstrating the importance of horizontal transfer for UPEC and the mosaic structure of the genome. UPEC strains contain a greater number of iron acquisition systems than do fecal/commensal strains, which is reflective of the adaptation to the iron-limiting urinary tract environment. Each strain displayed distinct differences in the number and type of known virulence factors. The large number of hypothetical genes in the CFT073 genome, especially those shown to be UPEC specific, strongly suggests that many urovirulence factors remain uncharacterized.
 ...
PMID:Defining genomic islands and uropathogen-specific genes in uropathogenic Escherichia coli. 1735 Oct 47

Corynebacterium urealyticum, formerly known as coryneform CDC group D2, was first recognized to be involved in human infections 30 years ago. It is a slow-growing, lipophilic, asaccharolytic and usually multidrug-resistant organism with potent urease activity. Its cell wall peptidoglycan, menaquinone, mycolic and cellular fatty acid composition is consistent with that of the genus Corynebacterium. DNA-DNA hybridization studies and 16S rDNA sequencing analysis have been used to determine the degree of relatedness of C. urealyticum to other corynebacterial species. The genome of the type strain consists of a circular chromosome with a size of 2 369 219 bp and a mean G + C content of 64.2%, and analysis of its genome explains the bacterium's lifestyle. C. urealyticum is a common skin colonizer of hospitalized elderly individuals who are receiving broad-spectrum antibiotics. It is an opportunistic pathogen causing mainly acute cystitis, pyelonephritis, encrusted cystitis, and encrusted pyelitis. More infrequently, it causes other infections, but mainly in patients with urological diseases. Infections are more common in males than in females, and treatment requires administration of antibiotics active against the organism in vitro, mainly glycopeptides, as well as surgical intervention, the latter mostly in cases of chronic infection. Mortality directly associated with infection by this organism is not frequent, but encrusted pyelitis in kidney-recipient patients may cause graft loss. The outcome of infection by this organism is reasonably good if the microbiological diagnosis is made and patients are treated appropriately.
 ...
PMID:Microbiological and clinical features of Corynebacterium urealyticum: urinary tract stones and genomics as the Rosetta Stone. 1855 35

Some risk factors for susceptibility to recurrent urinary tract infection (r-UTI) are well known, but the genetic role in acquiring the disease is poorly understood. Surfactant protein A and D (SP-A and SP-D) play an important role in modulation of lung inflammatory processes. The SP-A1 and SP-A2 genes encoding SP-A and the SP-D gene are highly polymorphic, and some of polymorphisms are associated with several infective diseases, including pyelonephritis. In the present study, we investigated whether some of these polymorphisms are associated with the risk of r-UTI in Chinese population. Genomic DNA was extracted from blood samples of 32 female patients with r-UTI and 30 age-matched, unrelated healthy female subjects. Genotyping of gene polymorphisms was analyzed by PCR. Among 11 single nucleotide polymorphisms (SNPs) (five of SP-A1, four of SP-A2 and two of SP-D) observed in the enrolled subjects, Ala19Val of SP-A1 and Lys223Gln of SP-A2 were associated with susceptibility to r-UTI. The frequencies of 19Ala allele of SP-A1 gene (p = 0.038) and 223Gln allele of SP-A2 gene (p = 0.012) in the patients were significantly higher than those in healthy subjects. The serum SP-A and SP-D levels were increased and the urine SP-A and SP-D levels were decreased in r-UTI patients compared with control subjects (p < 0.05). r-UTI patients with 19Ala/Ala or 223Gln/Gln genotype were associated with high serum and low urine SP-A levels (p < 0.01). Therefore, the 19Ala allele of SP-A1 gene and the 223Gln allele of SP-A2 gene are risk factors for r-UTI.
 ...
PMID:Polymorphisms in the surfactant protein a gene are associated with the susceptibility to recurrent urinary tract infection in chinese women. 2044 39

The uropathogenic Escherichia coli colonize the host body by attaching themselves to the epithelial cells through the pyelonephritis-associated pili (pap). The expression of the papBA operon is regulated under a reversible phase-variation mechanism, which partitions the population of cells into those that express the pap and others that do not. The two phases of pap expression are the direct consequences of the two distinct DNA-binding modes exhibited by leucine-responsive regulatory protein (Lrp) in the pap promoter region. In the phase-OFF cells, Lrp occupies the binding sites proximal to the transcription start, blocking transcription initiation. In the phase-ON cells, Lrp occupies the binding sites distal to the transcription start and is thought to promote the CAP (catabolite gene activation protein)-directed transcription initiation. Lrp binds to the proximal binding sites more tightly than to the distal sites, and the switching from phase-OFF to phase-ON requires a local co-regulator, PapI. Here, we used PapI and an isolated DNA-binding domain construct of Lrp to show that there is a DNA co-recognition mechanism by which both proteins acquire enhanced affinity to the distal pap site DNA, to which neither of them binds to an appreciable extent without the other. Also, examination of the binding properties of the Lrp DNA-binding domain presented here led us to propose a new sequence alignment of the six pap Lrp-binding sites. New insights into the design of sequences regulating the pap phase variation as revealed by the pap Lrp-binding site sequences are thus defined and discussed.
 ...
PMID:The design involved in PapI and Lrp regulation of the pap operon. 2133 11

F165(1) and the pyelonephritis-associated pili (Pap) are two members of the type P family of adhesive factors that play a key role in the establishment of disease caused by extraintestinal Escherichia coli (ExPEC) strains. They are both under the control of an epigenetic and reversible switch that defines the number of fimbriated (ON) and afimbriated (OFF) cells within a clonal population. Our present study demonstrates that the high level of ON cells found during F165(1) phase variation is due to altered stability of the DNA complex formed by the leucine-responsive regulatory protein (Lrp) at its repressor binding sites 1-3; after each cell cycle, complex formation is also modulated by the local regulator FooI (homologue to PapI) which promotes the transit of Lrp towards its activator binding sites 4-6. Furthermore, we identified two nucleotides (T490, G508) surrounding the Lrp binding site 1 that are critical to maintaining a high OFF to ON switch rate during F165(1) phase variation, as well as switching Pap fimbriae towards the OFF state.
 ...
PMID:Lrp-DNA complex stability determines the level of ON cells in type P fimbriae phase variation. 2175 6

Disseminated aspergillosis in dogs has been associated with Aspergillus terreus or A. deflectus infection. We report a case of disseminated A. versicolor infection presenting as diskospondylitis, osteomyelitis, and pyelonephritis. The diagnosis was made based on clinical, radiographic, and pathological findings. The etiologic agent was identified by fungal culture and internal transcribed spacer (ITS) ribosomal DNA (rDNA) sequencing. This is the first description of canine aspergillosis caused by A. versicolor.
 ...
PMID:Aspergillus versicolor, a new causative agent of canine disseminated aspergillosis. 2203 99

Most uncomplicated urinary tract infections (UTIs) are caused by uropathogenic Escherichia coli (UPEC). Both motility and adherence are integral to UTI pathogenesis, yet they represent opposing forces. Therefore, it is logical to reciprocally regulate these functions. In UPEC strain CFT073, PapX, a non-structural protein encoded by one of the two pap operons encoding P fimbria adherence factor, represses flagella-mediated motility and is a putative member of the winged helix transcription factor family. The mechanism of this repression, however, is not understood. papX is found preferentially in more virulent UPEC isolates, being significantly more prevalent in pyelonephritis strains (53% of isolates) than in asymptomatic bacteriuria (32%) or fecal/commensal (12.5%) strains. To examine PapX structure-function, we generated papX linker insertion and site-directed mutants, which identified two key residues for PapX function (Lys(54) and Arg(127)) within domains predicted by modeling with I-TASSER software to be important for dimerization and DNA binding, respectively. To determine the PapX binding site in the CFT073 genome, systematic evolution of ligands by exponential enrichment (SELEX) in conjunction with high throughput sequencing was utilized for the first time to determine a novel binding site for a bacterial transcription factor. This method identified a 29-bp binding site within the flhDC promoter (TTACGGTGAGTTATTTTAACTGTGCGCAA), centered 410 bp upstream of the flhD translational start site. Gel shift experiments demonstrated that PapX binds directly to this site to repress transcription of flagellar genes.
 ...
PMID:Determination of target sequence bound by PapX, repressor of bacterial motility, in flhD promoter using systematic evolution of ligands by exponential enrichment (SELEX) and high throughput sequencing. 2203 53

Levofloxacin is the synthetic L-isomer of the racemic fluoroquinolone, ofloxacin. It interferes with critical processes in the bacterial cell such as DNA replication, transcription, repair, and recombination by inhibiting bacterial topoisomerases. Levofloxacin has broad spectrum activity against several causative bacterial pathogens of community-acquired pneumonia (CAP). Oral levofloxacin is rapidly absorbed and is bioequivalent to the intravenous formulation such that patients can be conveniently transitioned between these formulations when moving from the inpatient to the outpatient setting. Furthermore, levofloxacin demonstrates excellent safety, and has good tissue penetration maintaining adequate concentrations at the site of infection. The efficacy and tolerability of levofloxacin 500 mg once daily for 10 days in patients with CAP are well established. Furthermore, a high-dose (750 mg) and short-course (5 days) of once-daily levofloxacin has been approved for use in the US in the treatment of CAP, acute bacterial sinusitis, acute pyelonephritis, and complicated urinary tract infections. The high-dose, short-course levofloxacin regimen maximizes its concentration-dependent antibacterial activity, decreases the potential for drug resistance, and has better patient compliance.
 ...
PMID:Cumulative clinical experience from over a decade of use of levofloxacin in community-acquired pneumonia: critical appraisal and role in therapy. 2204 7


<< Previous 1 2 3 4 5 6 7 8 9 10 Next >>