Gene/Protein
Disease
Symptom
Drug
Enzyme
Compound
Pivot Concepts:
Gene/Protein
Disease
Symptom
Drug
Enzyme
Compound
Target Concepts:
Gene/Protein
Disease
Symptom
Drug
Enzyme
Compound
Query: UMLS:C0034186 (
pyelonephritis
)
6,144
document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)
Gel
filtration through Sephadex (g 75 and 15) and ultrafiltration and diafiltration through selective membrances have been carried out on 172 uremic sera, 89 normal sera, uremic and normal urines and hemodialysis fluid. The accumulation in uremic sera of substances wwith molecular weights between 500 and 3,500 (so called "middle molecules") was demonstrated. Molecular weight evaluation was verified on single effluent fractions using different added isotopes. Evaporation of serum to dry weight revealed a 2-3 fold increase in solids compared to normal values. Estimation of the fractional content of individual elements and quantitative amino acid analysis (before and after acid hydrolysis) did not show any difference between normal and uremic subjects, but there was a significant increase of peptides in uremic serum. The accumulation of peptides was confirmed by high voltage electrophoresis. Urinary excretion of substances with comparable molecular weights to those found in uremic serum was demonstrated, but there was no significant difference between urine from normal and from uremic subjects. A steady state of chronic uremia with high urinary volume is therefore consistent with a normal urinary excretion of middle molecules with increased concentrations in serum and glomerular filtrate. Tubular reabsorption may also be decreased because the urinary excretion of middle molecules increases with the development of tubular proteinuria in patients with
pyelonephritis
. Dialysis treatment removes moderate amounts of middle molecules; their serum concentration decreases slightly after dialysis and they are detectable in dialysis fluid. The identification, metabolism and biological effects of middle molecules are discussed in relationship to uremic toxicity and the effects of different forms of dialysis treatment.
...
PMID:Middle molecules in uremic serum, urine and dialysis fluid. 113 3
Earlier studies on the binding of Escherichia coli adhesins to the human urinary tract have indicated that the ability to recognize binding sites on the urinary tract epithelial cells is not a characteristic for P fimbriae only, but is also shared by some other adhesins that are not associated with
pyelonephritis
, especially S fimbriae. In the present study we have investigated whether human urine contains inhibitors of the binding of E. coli adhesins. Normal human urine was found to inhibit hemagglutination by S and type 1 fimbriae but not P fimbriae. The major inhibitor of S fimbriae in normal urine was identified as Tamm-Horsfall glycoprotein, and the interaction with S fimbriae is probably mediated by its sialyloligosaccharide chains. No significant variation was observed in the inhibitory effect of T-H glycoprotein preparations originating from different individuals. In contrast to S fimbriae, the major inhibitors of type 1 fimbriae in urine were identified as low-molecular-weight compounds.
Gel
filtration and ion-exchange chromatography and alpha-mannosidase treatment indicated that they were neutral alpha-mannosides, probably manno-oligosaccharides with three to five saccharides. Studies of urine samples collected from several individuals indicated the common occurrence of these inhibitory alpha-mannosides. Type 1 fimbriae bound to immobilized T-H glycoprotein, but, unlike S fimbriae, their binding was poorly inhibited by soluble T-H glycoprotein. Some urine samples were also found to contain low-molecular-weight inhibitors for the O75X adhesin of E. coli. These results emphasize that to function as a virulence factor in human urinary tract infections, an adhesin must evidently recognize such receptor structures at the infection sites that are not excreted in soluble form in urine. This prerequisite is filled by P fimbriae but not by type 1 or S fimbriae.
...
PMID:Identification of factors in human urine that inhibit the binding of Escherichia coli adhesins. 290 5
Expression of
pyelonephritis
-associated pili (Pap) varies between transcriptionally active (ON) and inactive (OFF) phase states. Pap phase variation is controlled by the binding of leucine-responsive regulatory protein (Lrp) to two pap regulatory DNA regions, each containing a deoxyadenosine methylase site and designated GATC-I and GATC-II. Methylation of these GATC sites modulates binding of Lrp and plays an essential role in phase variation. PapI, an 8.8-kDa pap-encoded regulatory protein, plays a key role in the switch between OFF and ON transcription states. In the absence of PapI, Lrp binds to sites overlapping the papBA promoter and inhibits transcription. Addition of PapI results in a translocation of Lrp binding to sites over 100 bp upstream, resulting in the ON transcription state.
Gel
shift analysis using radiolabeled PapI shows that PapI binds with high specificity to Lrp-pap DNA complexes but binds only weakly to free Lrp. Protein cross-linking studies indicate that Lrp and PapI directly interact with each other. On the basis of these data, we present a hypothesis in which PapI facilitates the transition between OFF and ON transcription states by binding to Lrp and altering Lrp's affinity for the pap GATC-I and GATC-II regions.
...
PMID:Specific binding of PapI to Lrp-pap DNA complexes. 759 19
Most uncomplicated urinary tract infections (UTIs) are caused by uropathogenic Escherichia coli (UPEC). Both motility and adherence are integral to UTI pathogenesis, yet they represent opposing forces. Therefore, it is logical to reciprocally regulate these functions. In UPEC strain CFT073, PapX, a non-structural protein encoded by one of the two pap operons encoding P fimbria adherence factor, represses flagella-mediated motility and is a putative member of the winged helix transcription factor family. The mechanism of this repression, however, is not understood. papX is found preferentially in more virulent UPEC isolates, being significantly more prevalent in
pyelonephritis
strains (53% of isolates) than in asymptomatic bacteriuria (32%) or fecal/commensal (12.5%) strains. To examine PapX structure-function, we generated papX linker insertion and site-directed mutants, which identified two key residues for PapX function (Lys(54) and Arg(127)) within domains predicted by modeling with I-TASSER software to be important for dimerization and DNA binding, respectively. To determine the PapX binding site in the CFT073 genome, systematic evolution of ligands by exponential enrichment (SELEX) in conjunction with high throughput sequencing was utilized for the first time to determine a novel binding site for a bacterial transcription factor. This method identified a 29-bp binding site within the flhDC promoter (TTACGGTGAGTTATTTTAACTGTGCGCAA), centered 410 bp upstream of the flhD translational start site.
Gel
shift experiments demonstrated that PapX binds directly to this site to repress transcription of flagellar genes.
...
PMID:Determination of target sequence bound by PapX, repressor of bacterial motility, in flhD promoter using systematic evolution of ligands by exponential enrichment (SELEX) and high throughput sequencing. 2203 53
Paralogous transcriptional regulators MarA, Rob, and SoxS act individually and together to control expression of more than 80 Escherichia coli genes. Deletion of marA, rob, and soxS from an E. coli clinical isolate prevents persistence beyond 2 days postinfection in a mouse model of
pyelonephritis
. We used microarray analysis to identify 242 genes differentially expressed between the triple deletion mutant and its parent strain at 2 days postinfection in the kidney. One of these, znuC of the zinc transport system ZnuACB, displayed decreased expression in the triple mutant compared to that in the parental strain, and deletion of znuC from the parental strain reduced persistence. The marA rob soxS triple deletion mutant was less viable in vitro under limited-Zn and Zn-depleted conditions, while disruption of znuC caused a reduction in the growth rates for the parental and triple mutant strains to equally low levels under limited-Zn or Zn-depleted conditions. Complementation of the triple mutant with soxS, but not marA or rob, restored the parental growth rate in Zn-depleted medium, while deletion of only soxS from the parental strain led to low growth in Zn-depleted medium. Both results suggested that SoxS is a major regulator responsible for growth under Zn-depleted conditions.
Gel
shift experiments failed to show direct binding of SoxS to the znuCB promoter, thus suggesting indirect control of znuCB expression by SoxS. While SoxS expression in the triple mutant fully restored persistence, increased expression of znuACB via a plasmid in this mutant only partially restored wild-type levels of persistence in the kidney. This work implicates SoxS control of znuCB expression as a key factor in persistence of E. coli in murine
pyelonephritis
.
...
PMID:SoxS increases the expression of the zinc uptake system ZnuACB in an Escherichia coli murine pyelonephritis model. 2221 Jul 63