Gene/Protein Disease Symptom Drug Enzyme Compound
Pivot Concepts:   Target Concepts:
Query: UMLS:C0031511 (pheochromocytoma)
14,622 document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)

A 12-year-old boy with a norepinephrine-secreting pheochromocytoma that caused hypertension resistant to oral alpha adrenergic blockade is reported. Resistance to alpha adrenergic blocking agents developed when the patient's daily propranolol dosage was lowered from 10 to 1 mg/kg. Subsequently, alpha methyl tyrosine, an inhibitor of tyrosine hydroxylase, the rate-limiting enzyme in catecholamine biosynthesis, controlled the patient's blood pressure and was associated with reduction in total urinary catecholamine excretion. Norepinephrine content of the tumor and uninvolved adrenal gland removal at surgery was reduced. These findings confirm that alpha methyl tyrosine inhibited in vivo synthesis of catecholamines.
...
PMID:Childhood pheochromocytoma: treatment with alpha methyl tyrosine for resistant hypertension. 1 59

We have established a clonal cell line, PC-G2, from an experimentally induced rat pheochromocytoma. Administration of nerve growth factor to PC-G2 causes a 4- to 8-fold induction in the specific activity of tyrosine hydroxylase [tyrosine 3-monooxygenase; L-tyrosine,tetrahydropteridine:oxygen oxidoreductase(3-hydroxylating); EC 1.14.16.2]. The response is elicited in a dose-dependent fashion, at concentrations above 0.1 microgram/ml. Antiserum to nerve growth factor inhibited the induction of tyrosine hydroxylase. Dexamethasone enhances the nerve growth factor-mediated elevation of tyrosine hydroxylase. After 3--4 days of exposure to nerve growth factor the maximal induction of tyrosine hydroxylase is seen, although a significant increase can be observed after 24 hr. In contrast to the PC-12 cell line (derived from the same tumor), in which neurite outgrowth occurs in response to nerve growth factor, there is no morphological change or alteration in growth rate of PC-G2 cells after exposure to nerve growth factor.
...
PMID:Nerve growth factor-mediated induction of tyrosine hydroxylase in a clonal pheochromocytoma cell line. 3 87

The cellular localization of the enzymes tyrosine hydroxylase (TH), aromatic amino-acid decarboxylase (or dopa decarboxylase, DDC), dopamine beta-hydroxylase (DBH) and phenylethanolamine N-methyltransferase (PNMT) in the adrenal medulla of adult rats and rat fetuses (14th, 17th, 18th, 19th and 21st day) was examined. In the prenatal stages the medullary blastema and an adjacent part of the primitive sympathetic trunk were also investigated. Tissues were fixed in ice-cold 4% paraformaldehyde in 0.1 M phosphate buffer (pH 7.2). Cryostat sections (10 micron in thickness) were stained by the indirect immunofluorescence technique. Rabbit antibodies to TH (isolated from human pheochromocytoma), DDC, DBH and PNMT (the latter three isolated from bovine adrenal medulla) were used. Sections incubated with serum of non-immunized rabbits were used as controls. In the adult adrenal medulla, two cell types can be distinguished. One cell type contains only TH, DDC and DBH. The other cell type contains PNMT in addition. It is concluded that these cells correspond to the noradrenaline-(NA-) and adrenaline- (A-)storing cells respectively. In all prenatal stages TH, DDC and DBH are found in the primitive sympathetic trunk, in the medullary blastema, and in the medullary cells which have migrated into the cortical "anlage". PNMT is observed for the first time on the 18th day. Moreover, PNMT could only be demonstrated inside the adrenal gland. From these observations it is concluded that the capacity to synthesize NA is developed even before the "medullary" cells have reached the cortical "anlage". On the contrary, the capacity to synthesize A seems to be acquired only after this contact is established. The hypothesis is put forward that this phenomenon might indicate the induction of PNMT by glucocorticoids secreted by the fetal cortex.
...
PMID:Appearance of tyrosine hydroxylase, aromatic amino-acid decarboxylase, dopamine beta-hydroxylase and phenylethanolamine N-methyltransferase during the ontogenesis of the adrenal medulla: an immunohistochemical study in the rat. 4 Jul

Tyrosine hydroxylase (TH) activity has been determined in 22 neuroblastoma tumors from 15 patients, in 1 pheochromocytoma, 20 adrenal glands, 10 other tumors and organs, and 4 specimens of sera. The enzyme activity was found only in the neural crest tumors and adrenal glands, but the levels were too low to be detected in the other tumors and in normal liver and kidney tissues. The average specific activity (mean +/- SE) of TH in 23 neural crest tumors was 0.559 +/- 0.101; in 20 adrenal glands was 0.418 +/- 0.124 nmol/mg protein/minute. In 13 patients with neuroblastoma and 1 patient with pheochromocytoma, both TH levels in the primary tumors and urinary excretion of vanillylmandelic acid (VMA) and homovanillic acid (HVA) were studied. The urinary excretion of VMA by 10 of 13 neuroblastoma patients and by the patient with pheochromocytoma was significantly to markedly elevated above normal levels; excretion of HVA by 12 of 13 neuroblastoma patients was similarly elevated. These results indicate that tyrosine hydroxylase, an enzyme specifically located in the adrenal medulla and monoaminergic neurons, is also present in neuroblastoma, a malignant tumor of similar embryologic origin, and in pheochromocytoma. Not only can TH activity in these tumors be demonstrated in vitro, but the elevated urinary excretion of VMA and/or HVA by the majority of patients with these tumors also indicates TH activity of the tumors in vivo.
...
PMID:Studies on tyrosine hydroxylase in neuroblastoma in relation to urinary levels of catecholamine metabolites. 23 88

Protein kinase N (PKN) is a soluble, apparently novel serine protein kinase that is activated by nerve growth factor (NGF) and other agents in PC12 pheochromocytoma cells as well as in several nonneuronal cell lines. Purine analogs, such as 6-thioguanine and 2-aminopurine, have been found to inhibit PKN in vitro. When applied to intact cells, these compounds suppress certain biological responses to NGF, but not others, a findings suggesting the presence of multiple pathways in the NGF mechanism. We report here that 6-methylmercaptopurine riboside (6-MMPR) inhibits NGF-stimulated PKN activity in vitro with an apparent Ki of approximately 5 nM. This is approximately 1,000-fold lower than the Ki of the most potent purine inhibitor of PKN. Compounds similar to 6-MMPR, but lacking the methyl or riboside groups, were much less potent as PKN inhibitors. A survey of six additional purified protein kinases shows no inhibitory effect of 6-MMPR, thus indicating a good degree of specificity of this compound for PKN. In contrast to NGF-stimulated PKN, a PKN-like activity stimulated in PC12 cells in response to activation of cyclic AMP-dependent protein kinase was nearly insensitive to 6-MMPR. Application of 6-MMPR to intact PC12 cells resulted in blockade of several responses to NGF (neurite regeneration and ornithine decarboxylase induction) but not of several others (rapid enhancement of tyrosine hydroxylase phosphorylation and PKN activation). These findings suggest that 6-MMPR is a potent and selective agent for characterizing PKN in vitro and for assessing its potential role in the multiple pathways of the NGF mechanism of action.
...
PMID:6-Methylmercaptopurine riboside is a potent and selective inhibitor of nerve growth factor-activated protein kinase N. 130 69

Tryptic digestion of tyrosine hydroxylase (TH) isolated from rat adrenal glands labeled with 32Pi produced five phosphopeptides. Based on the correspondence of these phosphopeptides with those identified in TH from rat pheochromocytoma cells, four phosphorylation sites (Ser8, Ser19, Ser31, and Ser40) were inferred. Field stimulation of the splanchnic nerves at either 1 or 10 Hz (300 pulses) increased 32P incorporation into TH. At 10 Hz, the phosphorylation of Ser19 and Ser40 was increased, whereas at 1 Hz, Ser19, Ser31, and Ser40 phosphorylation was increased. Stimulation at either 1 or 10 Hz also increased the catalytic activity of TH, as measured in vitro (pH 7.2) at either 30 or 300 microM tetrahydrobiopterin. Nicotine (3 microM, 3 min) increased Ser19 phosphorylation, vasoactive intestinal polypeptide (10 microM, 3 min) increased Ser40 phosphorylation, and muscarine (100 microM, 3 min) increased TH phosphorylation primarily at Ser19 and Ser31. Vasoactive intestinal polypeptide, but not nicotine or muscarine, mimicked the effects of field stimulation on TH activity. Thus, the regulation of rat adrenal medullary TH phosphorylation by nerve impulses is mediated by multiple first and second messenger systems, as previously shown for catecholamine secretion. However, different sets of second messengers are involved in the two processes. The action of vasoactive intestinal polypeptide as a secretagogue involves the mobilization of intracellular calcium, whereas its effects on TH phosphorylation are mediated by cyclic AMP. This latter effect of vasoactive intestinal polypeptide and the consequent increase in Ser40 phosphorylation appear to be responsible for the rapid activation of TH by splanchnic nerve stimulation.
...
PMID:Activation and multiple-site phosphorylation of tyrosine hydroxylase in perfused rat adrenal glands. 134 70

Allostery of tyrosine hydroxylase was found by kinetical studies of partially purified tyrosine hydroxylase from clonal rat pheochromocytoma PC12h cells. Positive cooperativity toward the cofactors, (6R)-L-erythro-5,6,7,8-tetrahydrobiopterin [(6R)BH4] and (6S)-L-erythro-5,6,7,8-tetrahydrobiopterin [(6S)BH4], was observed. It is indicated that biopterin might be the regulatory factor of the enzyme polymers, which changes the affinity for the cofactor itself. Moreover, the stereochemical structure of (6R)BH4, the naturally-occurring cofactor, took an important role on the kinetical properties of the enzyme in concern with L-tyrosine.
...
PMID:Allosteric effect of tetrahydrobiopterin cofactors on tyrosine hydroxylase activity. 134 77

Tyrosine hydroxylase (TH) is phosphorylated at four sites in situ and in vivo, and the protein kinases that phosphorylate three of these sites (Ser8,Ser19,Ser40) have been identified. In intact cells, the phosphorylation of the fourth site (Ser31) is increased in response to phorbol esters or nerve growth factor (NGF). Here, we show that Ser31 is phosphorylated by ERK1 and ERK2, two myelin basic protein and microtubule-associated protein kinases. Extracts of NGF- or bradykinin-treated PC12 rat pheochromocytoma cells were fractionated on Mono Q columns. Protein kinase activity toward Ser31 in TH was present in two peaks corresponding to myelin basic protein kinase activities previously identified as ERK1 and ERK2. Phosphorylation of purified TH in vitro by both kinases was selective for Ser31 up to at least 0.6 mol of phosphate per mol of TH subunit. Treatment of intact PC12 cells with bradykinin or NGF increased both the phosphorylation of TH-Ser31 in situ and the catalytic activity of ERKs (measured subsequently in vitro with myelin basic protein as substrate). Pretreatment of the cells with genistein (a protein-tyrosine kinase inhibitor) decreased the bradykinin- but not the NGF-induced changes in both TH-Ser31 phosphorylation and ERK activity. Genistein also inhibited the increases in Ser31 phosphorylation produced by phorbol dibutyrate, muscarine, and Ba2+. The data indicate that ERK activity is responsible for phosphorylating TH at Ser31 in intact cells and suggest that TH-Ser31 phosphorylation may be regulated by multiple signaling pathways that converge at or prior to the activation of the ERKs.
...
PMID:ERK1 and ERK2, two microtubule-associated protein 2 kinases, mediate the phosphorylation of tyrosine hydroxylase at serine-31 in situ. 134 49

Transcription of tyrosine hydroxylase (TH), the rate-limiting enzyme in catecholamine biosynthesis, is regulated in a tissue-specific manner. We have identified sequences from -205 to -182 as the minimal enhancer for TH in pheochromocytoma cells using site-directed mutagenesis. This segment (TGATTCAGAGGCAGGTGCCTGTGA) is composed of an AP-1 motif (TGATTCA) and an overlapping 20 bp dyad whose core resembles an E box site (CANNTG). Interaction between the two elements is necessary both in vivo and in vitro: mutation of either element caused a 65%-95% reduction in transcription, and the combination of the two elements conferred cell-specific activation on a heterologous promoter; separation of the two elements by an additional helical turn not only disrupted a DNA-protein complex unique to the two elements, but also abolished expression in vivo. Therefore, we conclude that the interaction between the AP-1 and the E box dyad motifs is responsible for cell-specific TH expression.
...
PMID:Tissue-specific transcription of the rat tyrosine hydroxylase gene requires synergy between an AP-1 motif and an overlapping E box-containing dyad. 135 85

Tyrosine hydroxylase mRNA is induced in rat pheochromocytoma PC18 cells by cAMP analogs and glucocorticoids. Previous studies have shown that these increases in tyrosine hydroxylase mRNA are due at least in part to stimulation of the tyrosine hydroxylase gene. However, the involvement of post-transcriptional mechanisms in the regulation of tyrosine hydroxylase mRNA by these inducing agents has not been investigated. In the present study, using nuclear run-on assays we show that the relative transcription rate of the tyrosine hydroxylase gene is stimulated 2-5-fold within 20 min after treatment of PC18 cells with cAMP analogs or dexamethasone and that the rate of transcription remains elevated 2-3-fold for at least 24 hr in the continual presence of these inducing agents. Pulse-labeling experiments using 4-thiouridine indicate that the rate of synthesis of tyrosine hydroxylase mRNA is increased approximately 3-fold or 10-fold after treatment with either a cyclic AMP analog or dexamethasone, respectively. These increases in rates of synthesis agree well with the fold increases in tyrosine hydroxylase mRNA levels after treatment with these inducers. Treatment of the cells with cycloheximide lowers the basal relative transcription rate of the tyrosine hydroxylase gene 2-3-fold; however, the relative transcription rate of the tyrosine hydroxylase gene is still elevated in cells treated with either dexamethasone or cAMP analogs in the presence of cycloheximide, compared with the transcription rate of the gene in cells treated with cycloheximide alone. These results indicate that protein synthesis is not required for the short term regulation of the gene by these inducing agents. The apparent t1/2 for tyrosine hydroxylase mRNA has been estimated by two different procedures, approach to steady state kinetics and pulse-chase analysis. Both procedures yield an estimated apparent t1/2 of approximately 6-9 hr for tyrosine hydroxylase mRNA under basal culture conditions. Dexamethasone does not substantially alter this apparent t1/2 value; however, cAMP appears to lower this apparent t1/2 value transiently. Our results suggest that cAMP and glucocorticoid regulate tyrosine hydroxylase mRNA levels primarily by stimulating the transcription rate of the tyrosine hydroxylase gene; however, cAMP may also regulate the stability of the mRNA for a short period of time, such that it is induced more rapidly in the cells.
...
PMID:Regulation of tyrosine hydroxylase gene transcription rate and tyrosine hydroxylase mRNA stability by cyclic AMP and glucocorticoid. 135 99


1 2 3 4 5 6 7 8 9 10 Next >>