Gene/Protein Disease Symptom Drug Enzyme Compound
Pivot Concepts:   Target Concepts:
Query: UMLS:C0027651 (tumor)
685,946 document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)

In order to elucidate the cAMP regulatory elements in the promoter region of bovine P-450(11 beta) genes, we analyzed the promoter region using chloramphenicol acetyltransferase (CAT) gene as the reporter. Various deletion plasmids were constructed using the promoter region of CB11 beta-7, which is one of the two normal genes. Examination of the effects of Bt2cAMP on the CAT activities of mouse adrenal tumor cells (Y-1 cells) transfected with these deletion plasmids suggested that two elements named Ad3 and Ad4 play major roles in the induction by cAMP. Ad3(AAGATAAGGCACCCATCCATCTT) is located at -306 bp to -284 bp and Ad4 (CCAAGGTC) is located at -331 bp to -324 bp in the promoter region of the P-450(11 beta) gene. Deletions of both Ad3 and Ad4 resulted in a large decrease of the induction ratio from 9- to 3-fold. Coexistence of Ad3 and Ad4 is essential for their function, because any mutations introduced into either one of them resulted in a decrease of the cAMP induction ratio. These two elements are highly conserved among bovine, mouse, and human P-450(11 beta) genes and have no similarity with known cAMP regulatory elements. DNase I footprint analysis indicated that factors which specifically bind to the two elements exist in the nuclear extract of bovine adrenal cortex cells. Ad3 and Ad4 showed different patterns in gel shift analysis using probes which contained Ad3 or Ad4 sequence, suggesting their interaction with different nuclear factors. We also found two other protected regions by DNase I footprint analysis of the promoter regions of P-450(11 beta) gene, and named them Ad5 and Ad6.(ABSTRACT TRUNCATED AT 250 WORDS)
...
PMID:Novel cAMP regulatory elements in the promoter region of bovine P-450(11 beta) gene. 196 88

Identification of cis-regulatory sequences is a first step in analyzing the regulation of the human multidrug-resistant 1 (MDR1) gene which encodes the 170-kilodalton membrane P-glycoprotein in normal tissues and tumor cells. We have studied several overlapping genomic clones containing the 5'-flanking region of the gene. These clones span about 30 kilobases (kb) of contiguous DNA containing 10 kb of the gene and 20 kb of the 5'-flanking sequence. The nucleotide sequence of the first exon and the 2 kb preceding the exon were determined. DNA sequences containing the 5'-flanking regions were linked to the chloramphenicol acetyltransferase (CAT) gene. For transient CAT assay, we have employed six cell lines, including human cancer KB, vincristine-resistant VJ-300 derived from KB, mouse adrenal tumor Y-1, African green monkey kidney CV-1, mouse fibroblast NIH3T3, and human adrenal carcinoma SW-13 cells. Promoter activity was very weak regardless of the length of the promoter region in mouse adrenal tumor Y-1 and monkey kidney CV-1 cells, in which endogenous P-glycoprotein was expressed. Introduction of a 700-base genomic DNA fragment from a site located at 10 kb far upstream of the initiation site increased the transcription of the CAT gene in Y-1, CV-1, and SW-13 cells. However, no significant increase in the CAT activity could be observed in NIH3T3, KB, and VJ-300 cells. This fragment markedly augmented the expression of the CAT gene regardless of orientation or position, and it acted in a cell type-specific manner even with heterogenous promoters. Our present study suggests that the 700-base pair fragment may carry a tissue-specific transcriptional enhancer that is active in at least some adrenal and kidney-derived cell lines.
...
PMID:Tissue-specific enhancer of the human multidrug-resistance (MDR1) gene. 197 33

Proliferation-competent and differentiation-competent adult rat hepatocytes in primary culture were investigated for their ability to express reporter genes (firefly luciferase, bacterial chloramphenicol acetyltransferase, and bacterial beta-galactosidase) driven by tumor virus or eucaryotic promoters that vary in transcriptional efficiency and tissue specificity. Supercoiled plasmid DNA molecules were introduced into the cells by the calcium phosphate coprecipitation protocol of C. Chen and H. Okayama (Mol. Cell. Biol. 7:2745-2752, 1987). Reporter gene expression was virtually restricted to hepatocytes and was efficient (2 to 20% of the cells). The patterns and absolute levels of reporter gene expression depended on assay conditions employed (plasmid concentration [optimal at 2.4 micrograms of DNA per ml] and duration of exposure [optimal between 5 and 10 h]), culture growth cycle stages (lag, log, or stationary phase), properties and tissue specificity of the promoter(s) tested, and composition (and timing of fluid change) of the culture medium with or without the hepatocyte mitogen human transforming growth factor-alpha. Initial observations suggest that during hepatocellular growth transitions, human transforming growth factor-alpha differentially regulates exogenously introduced promoters associated with hepatocyte-specific function and proliferation. These findings provide a simple, fast, and powerful approach to analyzing the molecular and cellular biology of hepatocyte growth control.
...
PMID:DNA-mediated gene transfer into adult rat hepatocytes in primary culture. 210 58

The transcriptionally active RVL3-VL30 element contains a triple repeat of TGACTCC, a sequence nearly identical to the AP-1 binding site. However, 12-O-tetradecanoylphorbol-13-acetate (TPA) stimulation was unable to elicit chloramphenicol acetyltransferase (CAT) expression from a construct containing these AP-1-like sequences upstream of the thymidine kinase promoter present in pTES. Endothelin, which activates protein kinase C (pkC) and elevates intracellular Ca2+ in Rat-1 cells, was effective in stimulating CAT expression from the VL30-pTES construct. We attempted to assess the relative importance of these second messenger systems by stimulating each pathway separately with exogenous agonists. We determined that neither stimulation of pkC by the tumor promoter TPA nor elevation of intracellular Ca2+ by the tumor promoter thapsigargin was sufficient to stimulate CAT expression from the VL30-pTES vector. When combined, the two tumor promoters induced a synergistic increase in CAT expression. Our data indicate that elevation of intracellular Ca2+ by thapsigargin was not required for full activation of pkC by TPA. First, TPA was able to stimulate expression of other genes in Rat-1 cells, indicating full activation of pkC. Second, thapsigargin synergized effectively with epidermal growth factor to stimulate CAT activity from the VL30-pTES construct in cells depleted of pkC activity by chronic TPA treatment. The permissive effects of thapsigargin on gene expression were also observed for an endogenous gene, transin/stromelysin. The permissive effects of elevated intracellular Ca2+ levels may represent a general mechanism for the stimulation of some genes by pkC-mediated pathways.
...
PMID:Two tumor promoters, 12-O-tetradecanoylphorbol-13-acetate and thapsigargin, act synergistically via distinct signaling pathways to stimulate gene expression. 212 50

A consensus sequence in parvovirus nonstructural protein NS1 has been predicted to be an ATP-binding domain associated with an ATPase and a DNA helicase activity. To investigate the function of NS1 in viral gene expression, a site-directed mutagenesis converting NS1 lysine 405 to serine in parvovirus H-1 was carried out by the polymerase chain reaction. As shown previously, a parvovirus genome containing a deleted NS1 gene was excised from a bacterial plasmid and replicated when a wild-type NS1 gene was provided in trans but failed to be excised and replicate when the mutant NS1 gene was supplied. Interestingly, the serine 405 mutation totally lost the activity of trans activation on the virus late promoter (P38) in a chloramphenicol acetyltransferase (CAT) assay and it lost evidence for cytotoxicity in two tumor cell lines (HeLa Gey and NB324K). The serine 405 NS1 protein was translocated normally to the nucleus. These results suggest that the NS1 lysine 405 of H-1 in its putative purine nucleotide-binding site is essential for viral DNA replication and that this domain may be involved in the regulation of the P38 promoter by an unknown mechanism. The loss of NS1 cytotoxicity on tumor cells suggests that NS1 expression is the major cause of cell killing by parvoviruses, which may facilitate further study of the mechanism of oncosuppression by parvoviruses.
...
PMID:Mutation of lysine 405 to serine in the parvovirus H-1 NS1 abolishes its functions for viral DNA replication, late promoter trans activation, and cytotoxicity. 214 94

By utilizing chimeric genes constructed from 5'-flanking sequences of the human CYP21B (P-450C21) gene and reporter genes (chloramphenicol acetyltransferase or rabbit beta-globin), a 34-nucleotide sequence has been found to be required for cAMP-dependent transcription. This sequence (-129/-96 base pairs) shows no homology to that of the consensus (CRE) cAMP-regulatory element. Gel retardation analysis shows that a protein-DNA complex is formed between this DNA sequence and nuclear proteins from mouse adrenal Y1 tumor cells or bovine adrenal cortical cells or human fetal adrenal tissue and that formation of this complex cannot be competed by DNA containing the consensus CRE sequence. Even though cAMP-enhanced accumulation of P-450C21 mRNA in primary cultures of bovine adrenocortical cells is inhibited by the protein synthesis inhibitor, cycloheximide, reporter gene transcription enhanced by the cAMP-responsive -129/-96-base pair fragment of the human CYP21B gene is not. We conclude that cAMP-dependent transcription of the human P-450C21 gene (CYP21B), an event required for maintenance of optimal steroidogenic capacity in the adrenal cortex, involves a stable transcription factor(s) distinct from the CRE-binding protein. Furthermore the cAMP-dependent cis-regulatory element of the human P-450C21 gene is distinct from those found associated with the other steroid hydroxylase genes, 17 alpha-hydroxylase cytochrome P-450, cholesterol side chain cleavage cytochrome P-450, and 11 beta-hydroxylase cytochrome P-450, suggesting that each of these genes may require its own set of specific transcription factors for cAMP-dependent regulation.
...
PMID:cAMP-dependent transcription of the human CYP21B (P-450C21) gene requires a cis-regulatory element distinct from the consensus cAMP-regulatory element. 216 43

Tissue-type plasminogen activator (t-PA) gene expression is regulated by the tumor-promoting phorbol ester, phorbol-12-myristate 13-acetate (PMA), by cyclic AMP analogues, and the cAMP agonist, forskolin. Based on nuclear "run-on" transcription assays, t-PA expression is modulated by PMA on the level of transcription. 8-Bromo-cyclic AMP and forskolin do not induce t-PA gene transcription alone but act synergistically with PMA. These effects are confirmed by transient expression assays in HeLa cells employing deletion mutants of the t-PA gene promoter fused to the chloramphenicol acetyltransferase (CAT) reporter gene. Constitutive expression and most of the PMA-mediated induction requires sequences downstream of position -145. DNase I protection ("footprint") analysis of this region reveals two protein-binding sites: one between position -102 and -115, differing from the consensus sequence of the cAMP-responsive element (CRE) by the substitution of an adenine for a guanine in the middle of the core motif (TGACATCA), and another, located in the first exon (between position +60 and +74), displaying homology to the consensus sequence of the activator protein 2- (AP-2) binding site (CCCCACCCCC). Base substitutions in the core of either the CRE-like element or the AP-2 site suppress constitutive CAT expression by over 80%, whereas the relative PMA- and PMA plus cAMP-mediated responses are retained. CAT expression is below the detection limit when both elements are mutagenized together. Hence, the CRE-like element and the exon-located AP-2-binding site have a cooperative impact on basal transcription, but each element can independently convey the effect of activators of the protein kinase C- and A-dependent pathways of signal transduction. The results of band-shift analysis and competition titration experiments demonstrate that the CRE-like element acts as a low affinity binding site for the same proteins which recognize the authentic CRE.
...
PMID:A DNA motif related to the cAMP-responsive element and an exon-located activator protein-2 binding site in the human tissue-type plasminogen activator gene promoter cooperate in basal expression and convey activation by phorbol ester and cAMP. 216 21

The interferon (IFN)-gamma-mediated induction of indoleamine 2,3-dioxygenase (IDO) enzyme, which converts tryptophan into N-formylkynurenine, has been implicated in the inhibition of intracellular pathogens, e.g. Toxoplasma gondii and Chlamydia psittaci, and in the antiproliferative effect of IFN-gamma on tumor cells. The IDO activity is induced strongly in many cell types by IFN-gamma but rather poorly by IFN-alpha or -beta. A genomic DNA clone containing part of the transcribed region of the IDO gene and approximately 13 kilobases (kb) of the 5'-upstream DNA sequence was isolated and analyzed. An approximately 1.4-kb fragment of this clone, containing 329 nucleotides of the transcribed sequence and approximately 1.1 kb of the 5'-upstream sequence, when ligated to chloramphenicol acetyltransferase (CAT) structural gene made its expression inducible by IFN-gamma, but this construct responded poorly, if at all, to IFN-alpha 2. Deletion constructs derived from this plasmid narrowed down the IFN-gamma-responsive region to a 151-nucleotide segment (-495/-344) which also contained a 14-nucleotide sequence (GGTTTCAGTTTTCC) highly homologous to the IFN(alpha)-stimulated response element (ISRE) that has been found so far in all cellular genes inducible with IFN-alpha or -beta. Expression of CAT activity was stimulated by IFN-gamma more effectively than by IFN-alpha 2 when a 155-nucleotide fragment (-495/-340) containing the 151-nucleotide segment required for IFN-gamma response was inserted before herpes simplex virus thymidine kinase promoter linked to CAT structural gene. The results indicate that despite the presence of an ISRE, the control region of the IDO gene can distinguish between IFN-gamma and IFN-alpha. This may account for the differential activation of IDO gene expression by IFN-gamma as against IFN-alpha or -beta in intact cells, and suggests that the response of ISRE to IFN-alpha or -beta may be governed by other features in the upstream control region of this gene.
...
PMID:Regulation of indoleamine 2,3-dioxygenase gene expression in human fibroblasts by interferon-gamma. Upstream control region discriminates between interferon-gamma and interferon-alpha. 217 56

The rat gene encoding phenylethanolamine N-methyltransferase (PNMT) was cloned and a consensus sequence for a glucocorticoid response element (GRE) was found at -513 bp, 5' to the transcriptional start site. In order to define the function of this element, fusion genes containing the PNMT promoter and a chloramphenicol acetyltransferase (CAT) reporter gene were constructed. These constructs did not express after transfection into any of 7 continuous cell lines, none of which endogenously produce PNMT. A system for transfecting chromaffin cells in primary culture was therefore devised using constructs containing 200 bp of the proenkephalin (ENK) promoter, whose expression characteristics are well known. pENK beta GAL-1, containing the ENK promoter with a lac Z reporter, was introduced into these cells and beta-galactosidase activity was visualized in situ. Approximately 90% of cells transfected were chromaffin; transfection efficiency was 5%. High levels of CAT activity were measured in chromaffin cells transfected with pENKAT12, possessing a CAT reporter. In contrast to tumor cell lines, pENKAT12 induction in these cells by forskolin and phorbol esters did not require a phosphodiesterase inhibitor. In this chromaffin system, both basal and regulated expression of the PNMT fusion genes were detected. Dexamethasone (dex) induced expression of pPNMT3000 and pPNMT900, containing the putative GRE and 3000 bp or 863 bp of PNMT promoter sequence, 4- to 10-fold. Expression of pPNMT300 and pPNMT100, which lack the GRE and contain 273 bp or 99 bp of PNMT promoter sequence, was unaffected by dex. Addition of the PNMT region spanning -490 to -863 bp conferred full dex responsiveness to a thymidine kinase promoter. Deletion of the putative GRE sequence by site-directed mutagenesis abolished the dex response. These data identify the sequence at -513 bp in the rat PNMT gene as a functional, positively acting GRE. Primary cultures of bovine chromaffin cells provide a biologically relevant expression system for transcriptional studies of catecholamine genes and their related neuropeptides.
...
PMID:Identification of a functional glucocorticoid response element in the phenylethanolamine N-methyltransferase promoter using fusion genes introduced into chromaffin cells in primary culture. 230 57

We have analyzed the regulation of the alpha gonadotropin gene in eutopic placental cells and ectopic tumor cells by constructing a series of plasmid vectors containing alpha genomic 5' flanking DNA placed upstream of the gene encoding the bacterial enzyme chloramphenicol acetyltransferase (CAT). These plasmid DNAs were transfected into a eutopic (JAr) and an ectopic (HeLa) cell line. Both cell types expressed the CAT gene from plasmid constructs containing as much as 1,500 base pairs (bp) and as little as 140 bp of alpha 5' flanking DNA; JAr cells were considerably more efficient than HeLa cells. Ectopic and eutopic cells differed qualitatively in their expression from these alpha-CAT constructs when cells were treated with cAMP or butyrate. Butyrate induced alpha expression in HeLa cells but not in JAr cells, while cAMP induced expression in JAr cells. These results are consistent with and extend previous observations suggesting that there are cell-specific differences in the regulation of alpha gene expression in ectopic and eutopic cells. However, by using deletion constructs of the alpha-CAT gene, we found that the basal expression and cell-specific induction of the alpha gene in ectopic and eutopic cells were dependent on the same 140 bp of alpha 5' flanking DNA. These 140 bp were sequenced and found to contain a 9-bp stretch of DNA homologous with the consensus viral enhancer sequence. Such features of alpha expression common to both ectopic and eutopic cells may be involved in the coordinate expression of the alpha gene and the tumorigenic phenotype observed in each cell type.
...
PMID:Differential expression of the human gonadotropin alpha gene in ectopic and eutopic cells. 242 26


<< Previous 1 2 3 4 5 6 7 8 9 10 Next >>