Gene/Protein
Disease
Symptom
Drug
Enzyme
Compound
Pivot Concepts:
Gene/Protein
Disease
Symptom
Drug
Enzyme
Compound
Target Concepts:
Gene/Protein
Disease
Symptom
Drug
Enzyme
Compound
Query: UMLS:C0027651 (
tumor
)
685,946
document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)
Oxidative modification of genetic material has been implicated as a factor in carcinogenesis, particularly during promotion and progression, and therefore there is a need for sensitive detection of oxidized DNA bases. We developed a method that can be applied to DNA isolated from any source and used to simultaneously quantify oxidized nucleosides without a need to prelabel the DNA or use destructive hydrolytic procedures. This method is based on: (a) enzymatic DNA digestion; (b) HPLC separation of the resultant nucleosides; (c) acetylation of the oxidized nucleosides with [3H]Ac2O (acetic anhydride); (d) removal of the radioactive debris; and (e) quantitative analysis of tritiated nucleoside acetates by HPLC. Enzymatic DNA digestion was optimized using
DNase I
in the presence of Mg2+ (pH 7), followed by nuclease P1 in the presence of Zn2+ (pH 5.1) and alkaline phosphatase (pH 7.5). Analysis of DNA oxidized with H2O2 in the presence of Fe2+/EDTA for 30 min showed that the levels of 8-OHdG (8-hydroxy-2'-deoxyguanosine) were increased 2.7-fold, HMdU (5-hydroxymethyl-2'-deoxyuridine) 3.15-fold, and FdU (5-formyl-2'-deoxyuridine) 2.5-fold. Although the (-)-isomer of cis-dTG (cis-thymidine glycol) was enhanced 2.3 times, the (+)-isomer remained virtually unchanged. Analysis of DNA isolated from epidermal cells of mice treated in vivo with the
tumor
promoter TPA (12-O-tetradecanoylphorbol 13-acetate) showed 4.8-, 2.7-, and 8.7-fold increases in the levels of total cis-dTG, 8-OHdG, and HMdU, respectively, and of some unknown DNA oxidation products. These results prove applicability of the 3H-postlabeling method to the analysis of DNA (and potentially RNA) isolated from many sources, including animals and humans.
...
PMID:Quantitative high-performance liquid chromatography analysis of DNA oxidized in vitro and in vivo. 188 26
Regulation of human thyrotropin beta subunit gene (TSHB) expression by thyrotropin-releasing hormone (TRH) was examined in a clonal rat pituitary-cell line (GH3). Transient expression studies were done with various 5'-flanking DNA sequences of TSHB coupled to reporter gene chloramphenicol acetyltransferase. Deletion analysis defined two discrete regions (-128 to -92 base pairs and -28 to +8 base pairs) that each mediated an approximately 2-fold TRH induction. The upstream site contains a DNA sequence with close homology to the DNA-binding site for a pituitary-specific transcriptional factor Pit-1/GHF-1.
DNase I
footprinting analysis of mouse thyrotropic
tumor
extract as well as DNA-transfection studies using an expression vector containing an N-terminal deletion of Pit-1/GHF-1 cDNA suggest that Pit-1/GHF-1 or a closely related protein in the thyrotroph mediates TRH responsiveness of this gene. In addition, the downstream site overlaps with the recently characterized thyroid hormone-inhibitory element of TSHB. In fact, deletion of DNA sequences important in thyroid hormone-receptor binding (c-erbAB/c-ERBA2) from +3 to +8 base pairs, significantly reduced (30%) TRH responsiveness. The location of a TRH-stimulatory element near a thyroid hormone-inhibitory element may allow for fine control of TSHB expression in vivo.
...
PMID:Thyrotropin-releasing hormone regulation of human TSHB expression: role of a pituitary-specific transcription factor (Pit-1/GHF-1) and potential interaction with a thyroid hormone-inhibitory element. 190 56
Two regulatory regions in the murine collagen IV enhancer were identified. Transient transfection assays delimited a 210-base pair fragment within the first intron of the alpha 1(IV) collagen gene that had significant transcriptional enhancer activity.
DNase I
protection and gel mobility shift confirmed that two regions, designated footprints A and B, within this fragment bound nuclear factors. Gel shift studies suggested that the CCTTATCTCTGATGG motif (A-34) in the footprint A region was important for specific nuclear factor binding. Mutations in the A-34 motif abolished factor binding as detected by gel shift and resulted in a significant decrease in enhancer activity in transient transfection assays of F9 teratocarcinoma cells. Two putative transcription factors of Mr = 37,000 and Mr = 94,000, which interact with the A-34 motif, were purified from Engelbreth-Holm-Swarm
tumor
tissue using DEAE-Sephacel, heparin-Sepharose, salmon sperm DNA-Sepharose, and specific A-34 oligonucleotide affinity chromatography. Southwestern analysis revealed that both of these factors were capable of binding the A-34 oligonucleotide directly and did not require additional subunits for binding. These data suggest that positively acting transcription factor(s) interact with the A-34 site in the enhancer and are required for efficient transcription of the alpha 1 and alpha 2(IV) collagen chain genes.
...
PMID:Characterization of a cis-acting element required for efficient transcriptional activation of the collagen IV enhancer. 193 51
In order to elucidate the cAMP regulatory elements in the promoter region of bovine P-450(11 beta) genes, we analyzed the promoter region using chloramphenicol acetyltransferase (CAT) gene as the reporter. Various deletion plasmids were constructed using the promoter region of CB11 beta-7, which is one of the two normal genes. Examination of the effects of Bt2cAMP on the CAT activities of mouse adrenal
tumor
cells (Y-1 cells) transfected with these deletion plasmids suggested that two elements named Ad3 and Ad4 play major roles in the induction by cAMP. Ad3(AAGATAAGGCACCCATCCATCTT) is located at -306 bp to -284 bp and Ad4 (CCAAGGTC) is located at -331 bp to -324 bp in the promoter region of the P-450(11 beta) gene. Deletions of both Ad3 and Ad4 resulted in a large decrease of the induction ratio from 9- to 3-fold. Coexistence of Ad3 and Ad4 is essential for their function, because any mutations introduced into either one of them resulted in a decrease of the cAMP induction ratio. These two elements are highly conserved among bovine, mouse, and human P-450(11 beta) genes and have no similarity with known cAMP regulatory elements.
DNase I
footprint analysis indicated that factors which specifically bind to the two elements exist in the nuclear extract of bovine adrenal cortex cells. Ad3 and Ad4 showed different patterns in gel shift analysis using probes which contained Ad3 or Ad4 sequence, suggesting their interaction with different nuclear factors. We also found two other protected regions by
DNase I
footprint analysis of the promoter regions of P-450(11 beta) gene, and named them Ad5 and Ad6.(ABSTRACT TRUNCATED AT 250 WORDS)
...
PMID:Novel cAMP regulatory elements in the promoter region of bovine P-450(11 beta) gene. 196 88
Overexpression of the epidermal growth factor (EGF) receptor (c-erbB) proto-oncogene is a frequent occurrence in human carcinoma and appears to accompany autocrine or paracrine transforming growth factor-alpha expression, which in model systems can result in activation of EGF receptor tyrosine kinase activity and phenotypic transformation. Here we have investigated the transcriptional regulation of the EGF receptor gene, by run-on transcription in isolated nuclei derived from epithelioid
tumor
lines. The level of transcription was measured at various points on the 100-kilobase pair EGF receptor gene locus, on either sense or antisense DNA strands. We find the level of sense strand transcription along exon 1 is 8-fold higher than transcription in exons 2-26. Primary EGF receptor transcripts appear to pause or terminate prematurely between exons 1 and 2. Termination was mapped to a sequenced region approximately 2 kilobase pairs 3' of exon 1, proximal to a previously reported
DNase I
hypersensitive site and an enhancer-like activity. Transcription in the CpG-rich region surrounding exon 1 is bidirectional, with antisense transcripts initiating in intron 1 and extending through the coding first exon. Activation of protein kinase C results in a 5-fold induction of EGF receptor transcription, accompanied by a slow release in the block RNA elongation between exon 2 and exon 26, showing that EGF receptor RNA synthesis may be altered by changes in de novo transcription and by a block to RNA elongation.
...
PMID:Contributory effects of de novo transcription and premature transcript termination in the regulation of human epidermal growth factor receptor proto-oncogene RNA synthesis. 198 48
Nick-translation using mild digestion with
DNase I
allows preferential labeling of actively transcribing or potentially active genes, as compared with inactive genes. We have adapted this method to the level of electron microscopy to see the
DNase I
-sensitive regions in situ in Ehrlich
tumor
cells. In interphase cells treated with very low concentrations of
DNase I
, labeled sequences are found at the borders and in the close vicinity of condensed chromatin blocks. Labeling of condensed areas of chromatin requires higher
DNase I
concentrations and longer incubation in the nick-translation medium. In the nucleolus, the first sites to be nick-translated are the fibrillar centers and the interstices surrounding them, whereas the dense fibrillar component never contains labeled sequences. When cells are pretreated with actinomycin D, only a few perinucleolar clumps of condensed chromatin are labeled under the same conditions. This method provides a new tool for studying the functional organization of chromatin within a cell. The precise location of nick-translated sites in nucleolar components observed could change classical views concerning the functional organization of the nucleolus.
...
PMID:DNase I-sensitive sites within the nuclear architecture visualized by immunoelectron microscopy. 201 78
Tissue-type plasminogen activator (t-PA) gene expression is regulated by the
tumor
-promoting phorbol ester, phorbol-12-myristate 13-acetate (PMA), by cyclic AMP analogues, and the cAMP agonist, forskolin. Based on nuclear "run-on" transcription assays, t-PA expression is modulated by PMA on the level of transcription. 8-Bromo-cyclic AMP and forskolin do not induce t-PA gene transcription alone but act synergistically with PMA. These effects are confirmed by transient expression assays in HeLa cells employing deletion mutants of the t-PA gene promoter fused to the chloramphenicol acetyltransferase (CAT) reporter gene. Constitutive expression and most of the PMA-mediated induction requires sequences downstream of position -145.
DNase I
protection ("footprint") analysis of this region reveals two protein-binding sites: one between position -102 and -115, differing from the consensus sequence of the cAMP-responsive element (CRE) by the substitution of an adenine for a guanine in the middle of the core motif (TGACATCA), and another, located in the first exon (between position +60 and +74), displaying homology to the consensus sequence of the activator protein 2- (AP-2) binding site (CCCCACCCCC). Base substitutions in the core of either the CRE-like element or the AP-2 site suppress constitutive CAT expression by over 80%, whereas the relative PMA- and PMA plus cAMP-mediated responses are retained. CAT expression is below the detection limit when both elements are mutagenized together. Hence, the CRE-like element and the exon-located AP-2-binding site have a cooperative impact on basal transcription, but each element can independently convey the effect of activators of the protein kinase C- and A-dependent pathways of signal transduction. The results of band-shift analysis and competition titration experiments demonstrate that the CRE-like element acts as a low affinity binding site for the same proteins which recognize the authentic CRE.
...
PMID:A DNA motif related to the cAMP-responsive element and an exon-located activator protein-2 binding site in the human tissue-type plasminogen activator gene promoter cooperate in basal expression and convey activation by phorbol ester and cAMP. 216 21
Proteolysis by type IV collagenase (T4) has been implicated in the process of
tumor
metastasis. The T4 gene is expressed in fibroblasts, but not in normal epithelial cells, and its expression is specifically repressed by the E1A oncogene of adenovirus. We present an investigation of the transcriptional elements responsible for basal, E1A-repressible, and tissue-specific expression. 5'-Deletion analysis,
DNase I
footprinting, and gel mobility shift assays revealed a strong, E1A-repressible enhancer element, r2, located about 1,650 bp upstream of the start site. This enhancer bound a protein with binding specificity very similar to that of the transcription factor AP-2. A potent silencer sequence was found 2 to 5 bp downstream of this enhancer. The silencer repressed transcription from either r2 or AP-1 enhancer elements and in the context of either type IV collagenase or thymidine kinase (tk) gene core promoters; enhancerless transcription from the latter core promoter was also repressed. Comprising the silencer were two contiguous, autonomously functioning silencer elements. Negative regulation of T4 transcription by at least two factors was demonstrated. mcf-7 proteins specifically binding both elements were detected by gel mobility shift assays; a protein of approximately 185 kDa that bound to one of these elements was detected by DNA-protein cross-linking. The silencer repressed transcription, in an r2 enhancer-tk promoter context, much more efficiently in T4-nonproducing cells (mcf-7 or HeLa) than in T4-producing cells (HT1080), suggesting that cell type-specific silencing may contribute to the regulation of this gene.
...
PMID:Positive and negative transcriptional elements of the human type IV collagenase gene. 217 9
We now show that exposure of B16 melanoma cells to bromodeoxyuridine increases cell-substratum interactions concurrent with an increase in genome susceptibility to nucleases. Hypersensitive DNA was isolated after mild nicking of nuclei with
DNase I
followed by repair with DNA polymerase I in the presence of biotin-19-SS-dUTP and affinity chromatography on streptavidin-agarose. Dot blot studies showed that the hypersensitive DNA is enriched in c-myc sequences compared to total
tumor
genomic DNA, and hybridizes preferentially to the latter, compared to normal genomic DNA, particularly when prepared from BrdU-treated cells. Since hypersensitive DNA can hybridize with multiple Alu sequences in the genome, we postulate that one of the mechanisms for its differential reactivity may be by recognition of an unequal number of Alu repeats in normal and
tumor
genomic DNA.
...
PMID:Tumor hypersensitive DNA is enriched in c-myc sequences and reacts differentially with normal and malignant genomic DNA. 219 5
The interaction of partially purified calf uterine estradiol-charged estrogen receptor ([3H]ER) with rat nuclei was studied in vitro. We previously observed a significantly greater number of [3H]ER binding sites (at saturation) in nuclei of R3230AC mammary tumors from intact vs ovariectomized (ovex) rats with no difference in the affinity of [3H]ER binding for these nuclei. We now report on the nuclease sensitivity of [3H]ER binding sites in nuclei from these tumors and from normal rat tissues. Digestion of
tumor
nuclei with deoxyribonuclease I (
DNase I
) prior to incubation with [3H]ER in vitro resulted in a progressive loss of [3H]ER binding capacity, which was not accompanied by alterations in the affinity of [3H]ER for the nuclei (Kd = 1-3 nM). A significantly lower concentration (P less than 0.005) of
DNase I
eliminated 50% of the [3H]ER binding sites in nuclei of tumors from intact hosts (8 unit.min/ml) compared to tumors from ovex hosts (22 unit.min/ml). These results indicate that DNA regions capable of binding ER are more susceptible to
DNase I
digestion in tumors from intact rats than those from ovex hosts, suggesting that the endogenous hormonal milieu is responsible, at least in part, for maintenance of nuclease-sensitive DNA conformations in this hormone-responsive mammary tumor. The amount of
DNase I
required to eliminate 50% of [3H]ER binding to nuclei from lactating mammary gland, liver, and kidney ranged from 14 to 56 unit.min/ml. Therefore, accessibility of [3H]ER binding sites to nuclease digestion in normal rat tissue is generally less than that of R3230AC tumors.
...
PMID:Nuclease sensitivity of estradiol-charged estrogen receptor binding sites in nuclei isolated from normal and neoplastic rat mammary tissues. 219 77
<< Previous
1
2
3
4
5
6
7
8
9
10
Next >>