Gene/Protein Disease Symptom Drug Enzyme Compound
Pivot Concepts:   Target Concepts:
Query: UMLS:C0027627 (metastases)
 103,950 document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)

N-(2-Dialkylaminoethyl)benzamides have been shown to selectively accumulate in melanoma metastases with high uptake capacity. Therefore, this class of compound has previously been evaluated as a transporter for cytostatic drugs. It has been demonstrated that this significant targeting effect improves the cytotoxicity against melanoma cells. Although these agents are not accumulated by non-melanoma cells, they have been found to be toxic. In order to identify mechanistic reasons for this effect, we investigated the DNA and melanin binding affinities of a selection of four benzamide-drug conjugates, together with their parental cytostatics. An investigation of the influence of the melanin content on the cytotoxicity of these substances in B16 melanoma and Morris hepatoma (MH3924A) cells was performed, together with their influence on melanosomal pH and tyrosinase activity. The suppression of melanin formation with phenylisothiourea and the saturation of melanin binding sites with chloroquine were also investigated. These experiments demonstrated high DNA binding and low melanin affinity, in accordance with the toxicity against tumour cells. Melanin has a concentration-dependent scavenging effect, thereby reducing cytotoxicity. These compounds lead to an increase in the acidic pH of melanosomes, resulting in an increase in tyrosinase activity. The consequence of this reaction chain is an amplification of the scavenging effect for the benzamide-drug conjugates. These effects may be considered as limiting factors for the targeting characteristics of this class of compound, necessitating further modifications to the carrier system.
 ...
PMID:Alkylating benzamides with melanoma cytotoxicity: role of melanin, tyrosinase, intracellular pH and DNA interaction. 1617 65

The aim of this study was to evaluate the role of tyrosinase mRNA appearance in blood of malignant melanoma (MM) patients, especially with advanced stages, for predicting the disease progression, and consequently the survival. The tyrosinase mRNA was measured by nested RT-PCR in peripheral venous blood samples obtained from 86 patients (53 male and 33 female) with mainly stage III and IV MM. The data were analyzed using standard methods for survival analysis and logistic regression. Tyrosinase was negative in the MM patients with the disease stage I or II, positive tyrosinase was in 11/50 patients with stage III and in 5/22 patients with stage IV. Systemic metastases developed in 14/16 patients with positive tyrosinase and in 41/70 with negative tyrosinase. The 3-year survival was 8% and 28% among the patients with positive and the patients with negative tyrosinase, respectively. The log rank test showed statistically significant better survival of tyrosinase negative patients when compared to tyrosinase positive patients (p=0.039). Multivariate analysis using logistic regression indicated tyrosinase to be a statistically significant prognostic factor for the survival of MM patients after controlling for Breslow and ulceration values (p=0.006). Positive tyrosinase in peripheral venous blood is statistically significant, and more importantly independent negative predictor of survival.
 ...
PMID:Prognostic significance of tyrosinase mRNA detected by nested RT-PCR in patients with malignant melanoma. 1641 6

Over the past few decades, melanoma has shown the fastest growing incidence rate of all cancers. This malignancy is clinically defined by its potential to rapidly metastasize, and advanced metastatic melanomas are highly resistant to existing therapeutic regimens. Here, we report that PPI-2458, a novel, orally active agent of the fumagillin class of irreversible methionine aminopeptidase-2 (MetAP-2) inhibitors, potently inhibited the proliferation of B16F10 melanoma cells in vitro, with a growth inhibitory concentration 50% (GI50) of 0.2 nM. B16F10 growth inhibition was correlated with the inhibition of MetAP-2 enzyme, in a dose-dependent fashion, as determined by a pharmacodynamic assay, which measures the amount of uninhibited MetAP-2 following PPI-2458 treatment. Prolonged exposure of B16F10 cells to PPI-2458 at concentrations of up to 1 microM, 5,000-fold above the GI50, did not alter their sensitivity to PPI-2458 growth inhibition and no drug resistance was observed. Moreover, prolonged exposure to this agent induced melanogenesis, concomitant with the elevated expression of the melanocyte-specific enzymes tyrosinase and tyrosinase-related proteins (TRP) 1 and 2, a morphological feature associated with differentiated melanocytes. PPI-2458, when administered orally (p.o.), significantly inhibited B16F10 tumor growth in mice in a dose-dependent fashion, with a maximum inhibition of 62% at 100 mg/kg. This growth inhibition was directly correlated to the amount of irreversibly inhibited MetAP-2 (80% at 100 mg/kg PPI-2458) in tumor tissue. These data demonstrate that PPI-2458 has potent antiproliferative activity against B16F10 cells in vitro and in vivo, and that both activities are directly correlated with levels of MetAP-2 enzyme inhibition. This antiproliferative activity, coupled with additional observations from studies in vitro (absence of detectable resistance to PPI-2458 and induction of morphological features consistent with differentiated melanocytes), provides a rationale for assessing the therapeutic potential of PPI-2458 in the treatment of melanoma.
 ...
PMID:Inhibition of melanoma tumor growth by a pharmacological inhibitor of MetAP-2, PPI-2458. 1652 46

Because of its known heterogeneity, the analysis of antigen expression is crucial prior to the initiation of antigen-specific immunotherapy for melanoma. The melanoma differentiation antigens gp100, MART-1 and tyrosinase are involved in a common pathway of melanin synthesis. Peptides derived from these melanoma differentiation antigens are used in the immunotherapy of melanoma and antibodies recognizing these antigens are commonly applied to detect melanocytic lesions. One hundred and ninety-one paraffin-embedded melanoma metastases from 28 patients with 2-19 lesions (mean, 6.8) developing synchronously (n = 67) or asynchronously (n = 124) were analysed by immunohistochemistry for the expression of the melanoma differentiation antigens, as well as cancer/testis antigens of the melanoma antigen-A (MAGE-A) family (monoclonal antibodies 77B and 57B), anti-S100 and SM5-1. The overall reactivities were 81.6% (gp100), 79.5% (MART-1), 59.6% (tyrosinase), 59.1% (77B), 60.7% (57B), 93.2% (S100) and 91.6% (SM5-1). Twenty-seven lesions (14.1%) were positive for all tumour-associated antigens, 75 lesions (39.2%) were negative for one antigen and 87 lesions (45.5%) were negative for several tumour-associated antigens. Co-ordinated loss was found for lesions negative for gp100 and MART-1 (9.4%, P < 0.0005), gp100 and tyrosinase (11.0%, P = 0.009), MART-1 and tyrosinase (15.2%, P < 0.0005) and gp100, MART-1 and tyrosinase (8.9%, P < 0.0005), which is up to six times higher than the expected calculated loss. This co-ordinated loss of melanoma differentiation antigens in melanoma did not include cancer testis antigens and S100 or SM5-1. On average, the melanoma differentiation antigens stained 50-65% of cells within a lesion, and 10-39% of synchronous clusters were heterogeneous for melanoma differentiation antigen expression. In conclusion, broader polypeptide vaccines should be used for melanoma immunotherapy.
 ...
PMID:Concordant loss of melanoma differentiation antigens in synchronous and asynchronous melanoma metastases: implications for immunotherapy. 1656 69

Stem cell factor (SCF), next to various relevant biological effects exerted on many cell types, is able to keep melanocyte homeostasis through its receptor c-kit. Only a minority of metastatic melanoma cells (MMC) express c-kit receptor, but c-kit positive MMC move more slowly towards tumour progression and have a more natural tendency to undergo apoptosis. In our study c-kit positive MMC from human melanoma metastases and a c-kit positive human melanoma cell line-SK-MEL-28-showed a clear-cut reduction of cytokines normally up-regulated along melanoma progression after SCF stimulation. SCF was also able to maintain all MMC and SK-MEL-28 cells in a well differentiated status with an increase in organellogenesis and in particular of melanosomes in various degree of differentiation, but it did not induce apoptosis as observed in other in vitro models. The increase of melanosomes matched an increase of tyrosinase production. SCF did not modify the expression of NOS while it enhanced the expression of HLA-DR molecules on MMC membranes. Taken altogether these data stress the biological activity of SCF as a cytokine which is able to maintain MMC in a well differentiated status, and suggest a more in depth evaluation of possible effects of SCF on melanoma cells.
Clin Exp Metastasis 2006
PMID:Stem cell factor affects tumour progression markers in metastatic melanoma cells. 1702 24

We transfected the melanocyte-specific Mitf-M isoform into the aggressive melanoma UISO-Mel-6 cell lines. Our data show that Mitf decreases cell proliferation and results in cells which grow in clusters. By analyzing the expression of the markers of differentiation, we demonstrate that Mitf favored increased expression of tyrosinase and tyrosinase-related protein-1. In addition, Mitf induces Bcl-2 expression following transfection of UISO-Mel-6 cells. We also showed that Mitf gene affects cell-cycle distribution by resting cells preferentially in G2/G1 phase, and inducing the expression of p21 and p27. Moreover, we performed in vivo studies using subcutaneous injection of UISO-Mel-6 and UISO-Mel-6-Mitf in Balb/c nude mice. Our data show that Mitf inhibits tumor growth and decreases Ki67 expression. Tumors induced by UISO-Mel-6 cells were ulcerated and resulted in metastases to liver. None of the mice injected with UISO-Mel-6(Mitf+) cells harbored liver metastases. Our results suggest that Mitf is involved in melanoma differentiation and leads to a less aggressive phenotype.
 ...
PMID:Role of microphthalmia transcription factor (Mitf) in melanoma differentiation. 1726 27

Most of the melanoma markers used today are melanocytic markers or pigmentation pathway-associated genes driven by the microphthalmia transcription factor, MITF, and include among others, tyrosinase, dopachrome tautomerase, DCT, melan-A and S100B. Genomic studies repeatedly revealed several novel melanoma marker genes including those of the transcription factor NOTCH2, WNT5A, proliferation-associated genes TOPO2A and CDC2, membrane receptors FGFR and EphA3, adhesion molecules N-cadherin, beta3 integrin and syndecan-4, and the cell surface antigens CD59/protectin and MIA. Other genomic analyses tried to define the gene signature of the metastatic disease but failed to find a consistent one except the gold standard genes of beta3 integrin, syndecan-4 and WNT5a. Studies on the gene signatures of chemoresistance and cytokine sensitivity of melanoma clearly defined apoptosis-resistance as one of the key elements of the above biological properties, but the data are controversial, mostly because of the use of inappropriate model systems and the lack of confirmation on clinical samples. Accordingly, application of genomic technologies must be more "translational" to provide breakthrough in melanoma diagnosis and therapy.
 ...
PMID:Melanoma genomics reveals signatures of sensitivity to bio- and targeted therapies. 1743 76

The relationship between the disease course and the prognostic relevance of sequential tyrosinase reverse transcription-PCR assay in the peripheral blood of advanced metastatic melanoma patients was ascertained. The clinical usefulness of tyrosinase in stage IV melanoma patients is still debated, owing to the wide range of variability (positive expression from 30 up to 100% of patients) and the possibility of a transient shedding of melanoma cells into the bloodstream. A total of 200 consecutive stage IV metastatic patients treated at our department were included, 149 with active metastatic disease undergoing systemic therapies (group A), and 51 disease free after surgery (group B). For each patient, a baseline sample was obtained within 3 weeks of either the clinical/radiological demonstration of metastatic disease or the surgical treatment; thereafter, tyrosinase determinations were performed at day 1 of each therapy course before chemotherapy administration or at each follow-up visit. Tyrosinase expression was determined using standard reverse transcription-PCR nested techniques. A baseline positive determination was obtained in 72.5% of the patients with active metastatic disease (group A) but not in any of the patients who were disease free after surgery (group B). Therapy administration induced an early clearance of circulating melanoma cells, from 72.5 to 44.9% at the second down to 29.5% at the third determination. Tyrosinase expression before the third cycle was significantly associated with the clinical response: 56/81 (69.1%) patients with a negative tyrosinase determination obtained a response or a stable disease, whereas 29/34 (85.3%) patients with a positive test developed a progressive disease (P<0.001). A clinical response was observed in all the patients who had a negative tyrosinase at the first three determinations, although all patients whose first three determinations were positive developed a progressive disease. Multivariate analysis showed that baseline tyrosinase status carries an independent prognostic value on both overall survival and time to progression; moreover, tyrosinase results during follow-up were entered as time-dependent covariates in a multivariate analysis and were shown to be the most significant prognostic parameter associated to both overall survival and time to progression. In particular, the presence of a constant positive expression during follow-up was associated with the development of new metastatic sites in 95.6% of patients with active metastatic disease. Our results demonstrate that the discrepancies in the positive tyrosinase rates reported in the literature are related to the disease status at the time of sampling and to chemotherapy administration. Tyrosinase expression in the peripheral blood both at baseline and during follow-up can be considered a reliable prognostic parameter associated with the response to treatment, development of new metastatic sites, time to progression and survival.
 ...
PMID:Prognostic relevance of baseline and sequential peripheral blood tyrosinase expression in 200 consecutive advanced metastatic melanoma patients. 1749 82

A need for factors predictive of prognosis is present in patients who are diagnosed with malignant melanoma. The detection of circulating melanoma cells by reverse transcriptase-polymerase chain reaction for tyrosinase mRNA is a possible negative prognostic factor. The aim of this study was to assess the prognostic value of reverse transcriptase-PCR for tyrosinase mRNA in peripheral blood samples. From January 2000 to February 2003, duplicate blood samples were drawn from 114 melanoma patients following surgery and informed consent, and were tested with reverse transcriptase-PCR, for tyrosinase mRNA. Outer primers for the first PCR were R1 (sense): TTGGCAGATTGTCTGTAGCC and R2 (antisense): AGGCATTGTGCATGCTGCT. For the second round of PCR, nested primers were R3 (sense): GTCTTTATGCAATGGAACGC and R4 (antisense): GCTATCCCAGTAAGTGGACT. Threshold for detection of the technique was determined by adding serially diluted MelJuSo cells to healthy volunteer blood samples. Overall, 91 (79.1%) patients tested negative for tyrosinase mRNA and 24 (20.9%) tested positive. The number of patients who tested positive by stage was 3/38 (7.9%) for stage I, 3/22 (13.6%) for stage II, 5/30 (16.7%) for stage III and 13/24 (54.2%) for stage IV (P< 0.0001). 11/90 (12.2%) patients with no evidence of disease (stage I, II and III) tested positive and 13/24 (54.2%) patients with clinically confirmed distant metastases (stage IV) tested positive (P<0.00001). With median follow-up of 372 days or to death (range: 0-1303 days), median progression-free survival has not been reached for tyrosinase-negative patients and was 265 days for tyrosinase-positive patients (P<0.00001, log-rank test=21.07). Median overall survival was 344 days for tyrosinase-positive patients and has not been reached for tyrosinase-negative patients (P=0.0001, log-rank test=21.38). Stage, Breslow thickness and result of RT-PCR were significant prognostic factors for disease-free survival in a multivariate analysis, and stage was the only significant prognostic factor for overall survival. In conclusion, detection of circulating melanoma cells by reverse transcriptase-PCR for tyrosinase mRNA is a significant adverse prognostic factor for disease-free survival in patients with malignant melanoma.
 ...
PMID:Prognostic role of circulating melanoma cells detected by reverse transcriptase-polymerase chain reaction for tyrosinase mRNA in patients with melanoma. 1749 83

Twenty-four (24) pretreated patients with relapsed high-risk resected The American Joint Committee on Cancer (AJCC) stage IIA-IV melanoma received adjuvant peptide vaccinations derived from the melanosomal antigens MelanA/MART1, MAGE-1, gp100, and tyrosinase, according to patient tumor-associated human leukocyte antigen (HLA) restricted antigen expression, in combination with granulocyte-macrophage colony-stimulating factor (GM-CSF). Pretreatment was comprised of surgery (n=23 primary tumor; n=23 metastases), local radiotherapy (n=2), immunotherapy (n=23), chemotherapy (n=10), and chemoimmunotherapy (n=1), respectively. All patients received peptide vaccines in an adjuvant setting. Seven (7) patients were relapse free for 3+ up to 25+ months. Of the patients exhibiting progressive disease (n=17), 13 patients developed metastases during vaccination (9 local, 4 distant), and 4 patients developed metastases (2 local, 2 distant) after finishing vaccine therapy. Two (2)-year local and distant metastases-free survival, 2-year distant metastases-free survival, and 2-year overall survival were calculated as 8.6%, 68%, and 85%, respectively. Vaccine treatment was well tolerated, with no severe side-effects. Twenty (20) of 24 patients developed local delayed-type hypersensitivity (DTH) reactions to synthetic peptide vaccination. Transient fever (n=2) and pain in muscle/bone (n=2) occurred rarely. In conclusion, antigenic peptide vaccination, combined with GM-CSF, is safe and may yield clinical benefits in relapsed high-risk resected melanoma patients.
 ...
PMID:GM-CSF plus antigenic peptide vaccination in locally advanced melanoma patients. 1780 50


<< Previous 1 2 3 4 5 6 7 8 9 10