Gene/Protein Disease Symptom Drug Enzyme Compound
Pivot Concepts:   Target Concepts:
Query: UMLS:C0026918 (Mycobacterium)
 52,428 document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)

A gene amplification method of Mycobacterium tuberculosis DNA by the polymerase chain reaction (PCR) has been devised. A primer pair used in this study is 5'GTTGCCGTGGCGG TATCGG3' and 5'GCGACATTACGGGGCAGGTGG3', which brackets a 152-base region encoding the 65KD antigen, and a specific probe is 5'TTTGGGGTCATCTTTGGAGCG3'. The procedure could be completed within 2 days. The specificity and the sensitivity of the PCR for M. tuberculosis complex in identifying M. tuberculosis complex did not conflict with the conventional methods at all. Using this method, we could diagnose three cases of the disease, which had been very difficult to diagnose by the conventional methods, by detecting the DNA from the blood, liver biopsy specimen, lung aspirate, and pleural effusion.
 ...
PMID:Clinical application of the polymerase chain reaction for a rapid diagnosis of Mycobacterium tuberculosis infection. 147 60

The infection caused by Mycobacterium tuberculosis is highly prevalent in our country and is considered an emergent pathology in developed countries. The amplification of specific gene segments with diagnostics purposes is an alternative to identify fastidious and slow growing infective agents, being Mycobacterium tuberculosis one of them. Two polymerase chain reactions (PCR) directed to the amplification of a 294bp gene segment encoding a portion of a 65KD heat shock protein and 317 bp gene segment of a repetitive DNA segment (IS 6110) of Mycobacterium tuberculosis, have a sensibility of 80 to 91.3% and a specificity of 83.9 to 100% when used in the identification of Mycobacterium tuberculosis in 2 group of clinical samples, both compared to Koch's culture and or Ziehl-Neelsen stain. The diagnostic procedure is particularly useful in diagnosis of tuberculosis of extrapulmonary origin.
 ...
PMID:[Amplification of 2 different gene segments of Mycobacterium tuberculosis and its usefulness in the diagnosis of tuberculosis]. 808 58