Gene/Protein
Disease
Symptom
Drug
Enzyme
Compound
Pivot Concepts:
Gene/Protein
Disease
Symptom
Drug
Enzyme
Compound
Target Concepts:
Gene/Protein
Disease
Symptom
Drug
Enzyme
Compound
Query: UMLS:C0026827 (
hypotonia
)
5,860
document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)
A 9-month-old boy with presented generalised
hypotonia
, severe
cardiomyopathy
, and massive liver enlargement following 10 days of viral gastroenteritis. He was diagnosed with very long-chain acyl-CoA dehydrogenase deficiency and has been successfully treated.
...
PMID:Very long-chain acyl-CoA dehydrogenase deficiency in an infant presenting with massive hepatomegaly. 1222 61
Toriello-Carey syndrome is a rare malformative complex, described for the first time in 1988, characterized by agenesis of the corpus callosum, facial anomalies, cardiac defects and
hypotonia
. Relatively few neonatal cases have been reported. We describe here the first prenatal ultrasound diagnosis of the syndrome based on the detection of agenesis of the corpus callosum and spongious
cardiomyopathy
in a 22-week-old fetus of a couple with positive family history. The first sib of the couple was diagnosed with Toriello-Carey syndrome at 1 year of age, and had, in addition to the typical facial anomalies not detectable by ultrasound, agenesis of the corpus callosum and the same heart lesion (spongious
cardiomyopathy
). This report demonstrates that prenatal diagnosis of Toriello-Carey syndrome is feasible in the second trimester of pregnancy.
...
PMID:Prenatal ultrasound diagnosis of Toriello-Carey syndrome. 1247 30
Respiratory chain complex I deficiencies represent a genetically heterogeneous group of diseases resulting from mutations in either mitochondrial or nuclear DNA. Combination of denaturing high performance liquid chromatography and sequence analysis allowed us to show that a 4-bp deletion in intron 2 (IVS2+5_+8delGTAA) of the NDUFV2 gene (encoding NADH dehydrogenase ubiquinone flavoprotein 2) causes complex I deficiency and early onset hypertrophic cardiomyopathy with trunk
hypotonia
in three affected sibs of a consanguineous family. The homozygous mutation altering the consensus splice-donor site of exon 2 resulted in 70% decreased NDUFV2 protein and complex I deficiency. While mutation in a number of genes encoding complex I subunits essentially result in neurological symptoms, this first mutation in NDUFV2 is strikingly associated with
cardiomyopathy
, as previously observed in the unique case of NDFUS2 mutations.
...
PMID:Mutant NDUFV2 subunit of mitochondrial complex I causes early onset hypertrophic cardiomyopathy and encephalopathy. 1275 3
We report of an infant with neonatal glycogen storage disease type IV (GSD IV) who was examined for severe
hypotonia
and
cardiomyopathy
. On the muscle biopsy there were many fibers with diastase-resistant polyglucosan bodies. Glycogen branching enzyme (GBE1) activity in the muscle was markedly reduced. The infant had a homozygous single nucleotide deletion in the open reading frame of GBE1 gene.
...
PMID:A neonatal form of glycogen storage disease type IV. 1291 6
Long-chain fatty acids are important sources of respiratory fuel for many tissues and during fasting the rate of hepatic production of ketone bodies is markedly increased. Many extra hepatic tissues utilize ketone bodies in the fasted state with the advantage that glucose is "spared" for more vital tissues like the brain. This glucose sparing effect of ketones is especially important in infants where there is a high proportional glucose utilization in cerebral tissue. The first reported inherited defect affecting fatty acid oxidation was described in 1973 and to date about 15 separate disorders have been described. Although individually rare, cumulatively fatty acid oxidation defects are relatively common, have major consequences for affected individuals and their families, and carry significant health care implications. The major biochemical consequence of fatty acid oxidation defects is an inability of extra hepatic tissues to utilize fatty acids as an energy source with absent or limited hepatic capacity to generate ketones. Clinically patients usually present in infancy with acute life-threatening hypoketotic hypoglycaemia, liver disease, hyperammonaemia and cerebral oedema, with or without cardiac involvement, usually following a period of catabolic stress. Chronically there may be muscle involvement with
hypotonia
or exercise intolerance with or without
cardiomyopathy
. Treatment is generally by the avoidance of fasting, frequent carbohydrate rich feeds and for long-chain defects, the replacement of long-chain dietary fats with medium-chain formulae. Novel approaches to treatment include the use of d,l-3-hydoxybutyrate or heptanoate as an alternative energy source.
...
PMID:Implications of impaired ketogenesis in fatty acid oxidation disorders. 1476 88
Rare cases of suspected spinal muscular atrophy (SMA) have been found to have cytochrome c oxidase (COX) deficiency. To date, four cases with SMA features have been reported in children with mutations in the synthesis of cytochrome oxidase 2 (SCO2) gene. We report a male neonate who was born hypotonic, with persistent lactic acidosis, spontaneous activity with EMG testing, development of respiratory distress in the first few hours of life, and died at 30 days of age with progressive
cardiomyopathy
. Testing for survival motor neurone (smn) and NAIP deletions were negative and a skeletal muscle biopsy showed neurogenic features with severe reductions of COX enzymatic and histochemical staining intensity. Post-mortem muscle, heart, and liver biopsies showed severe, moderate, and mild reductions in COX activity, respectively, with parallel findings in the protein content for the mitochondrial DNA (COII) and nuclear DNA (COIV) encoded subunits. DNA sequencing of exon 2 of the SCO2 gene revealed compound heterozygosity with mutations at G1541A (common mutation, E140K) and also at a novel site in the copper binding region (G1521A in the current case (converting a highly conserved cysteine to tyrosine [corrected] (C133Y) [corrected]); mother heterozygous for G1521A; and father heterozygous for G1541A). This case provides strong support that SCO2 mutations can result in neonatal
hypotonia
with an SMA 1 phenotype. SCO2 mutations should be screened in suspected SMA cases with normal smn mutation analysis and any one of;
cardiomyopathy
, lactic acidosis, or COX deficiency in muscle.
...
PMID:Novel SCO2 mutation (G1521A) presenting as a spinal muscular atrophy type I phenotype. 1499 43
Molecular diagnosis of mitochondrial DNA disorder is usually focused on point mutations and large deletions. In the absence of detectable mtDNA mutations, abnormal amounts of mtDNA, either depletion or elevation, can be indicative of mitochondrial dysfunction. The amount of mitochondrial DNA (mtDNA), however, varies among individuals of different ages and among different tissues within the same individual. To establish a range of mtDNA levels, we analyzed 300 muscle and 200 blood specimens from patients suspected of having a mitochondrial disorder by real-time quantitative polymerase chain reaction (PCR) method. Copy numbers were calculated from the standard curve and threshold cycle number using TaqMan probes; 6FAM 5'TTACCGGGCTCTGCCATCT3'-TAMRA and VIC-5'AGCAATAACAGGTCTGTGATG3'-TAMRA for mtDNA and 18S rRNA gene (nDNA), respectively. The copy number ratio of mtDNA to nDNA was used as a measure of mtDNA content in each specimen. The mtDNA content in muscle increases steadily from birth to about 5 years of age; thereafter, it stays about the same. On the contrary, the mtDNA content in blood decreases with age. The amount of mtDNA in skeletal muscle is about 5-20 times higher than that in blood. About 7% of patients had mtDNA levels in muscle below 20% of the mean of the age-matched group, and about 10% of patients had muscle mtDNA levels 2- to 16-fold higher than the mean of the age-matched group. Patients with abnormal levels of mtDNA, either depletion or proliferation, had significant clinical manifestations characteristic of mitochondrial disease in addition to abnormal respiratory enzymes and mitochondrial cytopathies.
Cardiomyopathy
, lactic acidosis, abnormal brain MRI findings,
hypotonia
, developmental delay, seizures, and failure to thrive are general clinical pictures of patients with mtDNA depletion. The average age of patients with mtDNA depletion is 4.1 years, compared to 23.6 years in patients with mtDNA proliferation. Mutations in nuclear genes involved in mtDNA synthesis and deoxynucleotide pools are probably the cause of mtDNA depletion. Our results demonstrate that real time quantitative PCR is a valuable tool for molecular screening of mitochondrial diseases.
...
PMID:Quantitative PCR analysis of mitochondrial DNA content in patients with mitochondrial disease. 1512 6
Glycogen storage disease type II (GSD-II), also known as Pompe disease, is a rare autosomial recessive disease due to deficiency of lysosomal acid alpha-glucosidase (GAA). The infantile-onset form is the most severe, and most patients present with
hypotonia
and
cardiomyopathy
in early infancy. We report on a typical case of Pompe disease in a patient who died at 8 months of age due to aspiration pneumonia and hypertrophic cardiomyopathy. Genetic studies showed deficient GAA activity and mutation of the GAA gene with Gly615Arg (exon 13, G1845A). On autopsy, glycogen had markedly accumulated in the liver, myocardium and skeletal muscle. The neurons of the anterior horn of the spinal cord and medulla were also involved, but the cortex was spared. These neurological-histologic findings may explain the clinical features of poor motor function, decreased deep tendon reflexes and lack of mental retardation.
...
PMID:Infantile-onset glycogen storage disease type II (Pompe disease): report of a case with genetic diagnosis and pathological findings. 1536 15
Malonyl-CoA decarboxylase deficiency is an inborn error of metabolism that may cause
hypotonia
and a fatal
cardiomyopathy
in infancy. Newborn metabolic screening programs do not include this disorder, although there is a possibility that presymptomatic treatment may attenuate the development of
cardiomyopathy
. We report a case of malonyl-CoA decarboxylase deficiency in a 5-month-old boy who presented with
cardiomyopathy
and
hypotonia
. Retrospective analysis of the newborn screening test showed an elevation in the concentration of malonylcarnitine at age 3 days. Unfortunately, this perturbation was missed because the screening test did not routinely measure malonylcarnitine in the newborn blood. Our experience confirms the possibility of screening for malonyl-CoA decarboxylase deficiency with tandem mass spectrometry. This finding should enable studies to determine if presymptomatic treatment could change the outcome in this often fatal disorder.
...
PMID:Cardiomyopathy and hypotonia in a 5-month-old infant with malonyl-coa decarboxylase deficiency: potential for preclinical diagnosis with expanded newborn screening. 1607 22
We describe two patients affected by Barth syndrome. Their symptoms became manifest on respectively the third and first day of their lives. Clinical presentation included poor sucking, lethargy,
hypotonia
, hypothermia and
cardiomyopathy
. Laboratory findings such as hypoglycaemia, metabolic acidosis, elevated transaminases, hyperlactacidaemia and mild hyperammonaemia pointed to an inborn error of energy metabolism with possible mitochondrial involvement. Molecular analysis of the TAZ (G4.5) gene showed the c.877G > A mutation leading to the G197R amino acid substitution in patient 1, and the new splice donor c.829 + 1G > A genetic lesion in patient 2.
...
PMID:Barth syndrome presenting with acute metabolic decompensation in the neonatal period. 1690 70
<< Previous
1
2
3
4
5
6
7
8
9
10
Next >>