Gene/Protein Disease Symptom Drug Enzyme Compound
Pivot Concepts:   Target Concepts:
Query: UMLS:C0026827 (hypotonia)
 5,860 document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)

A newborn male with mitochondrial complex I deficiency suffered from neonatal epileptic seizures, which later developed into infantile spasms. The infant was blind due to aplasia of the retinal vessels and hypoplasia of the optic nerve. There was congenital lactic acidosis, which persisted in later life. The boy was microcephalic and retarded. Muscular hypotonia later shifted to spasticity. Succinic acid was increased in urine. We assume that the aplasia of the retinal vessels is due to damage of the retinal ganglion cells caused by the mitochondrial disease in the first 3 to 4 months of pregnancy.
 ...
PMID:Aplasia of the retinal vessels combined with optic nerve hypoplasia, neonatal epileptic seizures, and lactic acidosis due to mitochondrial complex I deficiency. 139 14

Fatal infantile mitochondrial myopathy with lactic acidosis, morphologically abnormal mitochondria, deficient cytochromes aa3 and b, and a Fanconi-like aminoaciduria has been described. We report two infants, second cousins, with a similar fatal mitochondrial disorder, the cytochrome deficiency limited to skeletal muscle in one child and to liver in the other. The first child at 3 months of age had weight loss, hypotonia, external ophthalmoplegia, and a severe lactic acidosis with a high lactate/pyruvate ratio. Electron microscopy of muscle showed marked proliferation of enlarged mitochondria, many containing concentric rings of cristae. In skeletal muscle mitochondria, cytochromes aa3 and b were not detectable but cytochrome cc was found to be normal by spectroscopy. Cytochrome c oxidase activity was less than 1% of normal. Mitochondria from kidney, liver, heart, lung, and brain examined postmortem had normal cytochromes and preserved cytochrome c oxidase activity. The second cousin at 5 months of age had weight loss and hepatomegaly but no systemic lactic acidosis. Liver biopsy showed hepatocytes packed with enlarged mitochondria. The liver mitochondria showed deficient cytochromes aa3 and b postmortem, and cytochrome c oxidase activity was less than 10% of normal. Kidney mitochondria had normal cytochromes. Muscles was not studied. The mitochondrial abnormality in the two cousins presumably is related. Unexplained are the mode of genetic transmission or environmental exposure and the apparent involvement of a single different organ in each child.
 ...
PMID:Mitochondrial cytochrome deficiency presenting as a myopathy with hypotonia, external ophthalmoplegia, and lactic acidosis in an infant and as fatal hepatopathy in a second cousin. 631 75

Fourteen patients (10 boys, 4 girls) aged from 4 months to 14 years old were diagnosed with mitochondrial disease based on the clinical manifestations together with abnormal muscle mitochondrial morphologies. Their clinical diagnoses included Leigh syndrome, three; Menkes' syndrome, three; Kearns-Sayre syndrome, two; myoclonic epilepsy with ragged fibres, one; and infant-onset progressive myoclonic epilepsy, one; fatal infantile mitochondrial myopathy, one; fatty acid oxidation defect, two; and myopathy with cardiopathy, one. Organs involved other than muscles included central nervous system, ten; heart, six; eye, two; liver, two; and kidney, two. Clinical manifestations varied to include hypotonia, seizures, myoclonus, mental retardation, nystagmus, ataxia, ptosis, ophthalmoplegia, retinal degeneration, muscle atrophy, spasticity etc. Nine had an abnormal rise in lactate after glucose loading. Ragged-red fibres were found in four patients. Abnormal mitochondrial morphology included abnormal accumulation, abnormal cristae pattern of tubular, concentric, or parallel form, some contained osmiophilic inclusion bodies. One patient of Leigh syndrome had had brain necropsy which showed intramyelin splitting of myelinated axons.
 ...
PMID:Clinical manifestation of mitochondrial diseases in children. 821 54

Heat shock protein 60 (hsp60) is a mitochondrial matrix protein involved in the folding and correct assembly of polypeptides into complex mitochondrial enzymes. Its deficiency has recently been described as the most likely primary cause of congenital lactic acidaemia with multiple mitochondrial enzyme deficiencies in a female patient. We describe a new case of a girl with a substantially decreased amount of hsp60 in cultured fibroblasts. She presented from birth with hypotonia, unusual facial features, feeding difficulties and failure to thrive. Death occurred at age 4.5 years. Biochemical findings included metabolic acidosis with lactic acidaemia, hyperammonaemia and intermittent ketosis. In contrast to the previously reported case, organic acid analysis showed an altered profile throughout her life. In agreement with this profile, various mitochondrial enzyme activities were deficient in cultured fibroblasts, including enzymes of the respiratory chain and the Krebs cycle, the pyruvate dehydrogenase complex and the mitochondrial biotindependent carboxylases. Fibroblast mitochondria showed ultrastructural abnormalities, were swollen, and were mainly localized around the nucleus. The description of a second case of multiple mitochondrial enzyme deficiencies with reduced amount of hsp60 supports the idea that hsp60 deficiency might be a more common cause of mitochondrial disease. This opens new possibilities for the diagnosis and understanding of congenital lactic acidaemia.
 ...
PMID:A new case of multiple mitochondrial enzyme deficiencies with decreased amount of heat shock protein 60. 926 94

We describe a neonate with hypotonia, weakness, early death owing to respiratory failure, and a severe form of arthrogryposis multiplex congenita. Postmortem studies revealed numerous ragged-red fibers and central nervous system abnormalities consistent with a mitochondrial disease. No NADH:ubiquinone-1 oxidoreductase (complex I) activity could be detected in skeletal muscle. These findings suggest that mitochondrial cytopathies can be associated with arthrogryposis multiplex congenita and should therefore be sought in neonates presenting with severe arthrogryposis.
 ...
PMID:Ragged-red fibers and complex I deficiency in a neonate with arthrogryposis congenita. 939 Jul 2

We report three children, each of whom seemed to have a primary mitochondrial disorder at presentation but was eventually diagnosed with an extramitochondrial inherited metabolic disease. The first patient presented at 6 months with developmental delay. Magnetic resonance imaging showed an abnormal signal in the white matter, and magnetic resonance spectroscopy showed elevated lactate peaks. A muscle biopsy showed complex IV deficiency, but leukocyte measurement of galactosylceramide beta-galactosidase activity was markedly diminished, consistent with Krabbe's disease. The second patient presented at birth with seizures and later had developmental delays. There was brain atrophy on neuroimaging. Serum and cerebrospinal fluid lactate levels were elevated. She had persistently elevated urine thiosulfate, which was diagnostic for molybdenum cofactor deficiency. The third child presented at 2 months with seizures and hypotonia. Magnetic resonance imaging showed an abnormal signal in the basal ganglia and surrounding white matter, whereas magnetic resonance spectroscopy showed elevated lactate peaks. A brain biopsy was diagnostic for Alexander's disease. These cases and others in the literature suggest that lactic acid elevation in the central nervous system can be found in a number of extramitochondrial neurologic diseases. Such diseases would constitute a third category of lactic acidosis.
 ...
PMID:Lactic acid elevation in extramitochondrial childhood neurodegenerative diseases. 1157 6

Mitochondrial cytopathies are caused by genetic alterations of nuclear- or mitochondrial-encoded genes involved in the synthesis of subunits of the electron transport chain. Mutations of mitochondrial DNA are associated with a wide range of clinical presentations [1-4]. The ubiquitous nature of mitochondria and the role of the mitochondria in cellular metabolism result in the potential for any tissue in the body to be affected [5-7,8..,9]. Although some children with mitochondrial disease present with life-threatening lactic acidosis in the newborn period, the majority of children come to clinical attention for nonspecific problems, including failure to thrive, developmental delay, seizures, hypotonia, and loss of developmental milestones. The diagnosis of these disorders is made through careful clinical evaluation, coupled with biochemical, morphologic, and molecular biologic techniques. Genetic counseling is difficult due to unique aspects of mitochondrial genetics. Despite advances in our understanding of mitochondrial biochemistry and genetics, treatment options remain limited.
 ...
PMID:Diagnosis and treatment of childhood mitochondrial diseases. 1189 15

Macrophagic myofasciitis has been almost exclusively detected in adults only. We describe six children of Arab Moslem origin with this disorder. Three presented with hypotonia, developmental delay and seizures and were evaluated for a mitochondrial disorder. The other three children had hypotonia and predominantly motor delay. Five of the six families were consanguineous. A massive collection of macrophages was present in the fascia and adjacent epimysium in all biopsies. The macrophages were periodic-acid-Schiff positive and immunoreactive for CD68. One biopsy which was evaluated by electron microscopy and energy-dispersive X-ray microanalysis showed crystalline structures containing aluminum in macrophages. Two children with motor delay and hypotonia were treated with oral prednisone for 3 months with no clinical improvement. Genetic predisposition probably accounts for the variability in the prevalence of macrophagic myofasciitis in different populations. At least in childhood, there seems to be no connection between macrophagic myofasciitis as a pathological entity and the clinical symptoms and signs.
 ...
PMID:Childhood macrophagic myofasciitis-consanguinity and clinicopathological features. 1501 2

Molecular diagnosis of mitochondrial DNA disorder is usually focused on point mutations and large deletions. In the absence of detectable mtDNA mutations, abnormal amounts of mtDNA, either depletion or elevation, can be indicative of mitochondrial dysfunction. The amount of mitochondrial DNA (mtDNA), however, varies among individuals of different ages and among different tissues within the same individual. To establish a range of mtDNA levels, we analyzed 300 muscle and 200 blood specimens from patients suspected of having a mitochondrial disorder by real-time quantitative polymerase chain reaction (PCR) method. Copy numbers were calculated from the standard curve and threshold cycle number using TaqMan probes; 6FAM 5'TTACCGGGCTCTGCCATCT3'-TAMRA and VIC-5'AGCAATAACAGGTCTGTGATG3'-TAMRA for mtDNA and 18S rRNA gene (nDNA), respectively. The copy number ratio of mtDNA to nDNA was used as a measure of mtDNA content in each specimen. The mtDNA content in muscle increases steadily from birth to about 5 years of age; thereafter, it stays about the same. On the contrary, the mtDNA content in blood decreases with age. The amount of mtDNA in skeletal muscle is about 5-20 times higher than that in blood. About 7% of patients had mtDNA levels in muscle below 20% of the mean of the age-matched group, and about 10% of patients had muscle mtDNA levels 2- to 16-fold higher than the mean of the age-matched group. Patients with abnormal levels of mtDNA, either depletion or proliferation, had significant clinical manifestations characteristic of mitochondrial disease in addition to abnormal respiratory enzymes and mitochondrial cytopathies. Cardiomyopathy, lactic acidosis, abnormal brain MRI findings, hypotonia, developmental delay, seizures, and failure to thrive are general clinical pictures of patients with mtDNA depletion. The average age of patients with mtDNA depletion is 4.1 years, compared to 23.6 years in patients with mtDNA proliferation. Mutations in nuclear genes involved in mtDNA synthesis and deoxynucleotide pools are probably the cause of mtDNA depletion. Our results demonstrate that real time quantitative PCR is a valuable tool for molecular screening of mitochondrial diseases.
 ...
PMID:Quantitative PCR analysis of mitochondrial DNA content in patients with mitochondrial disease. 1512 6

Maple syrup urine disease (MSUD) is a metabolic disorder due to a block in the decarboxylation step in the catabolic pathways of the branched-chain amino acids (BCAAs). We describe an atypical presentation in an infant male. The patient presented with psychomotor retardation, profound hypotonia and elevated plasma levels of BCAAs, but no elevation of alloisoleucine. Cranial magnetic resonance imaging showed prominent diffuse CSF spaces, delayed myelin maturation and symmetrical signal abnormality within the globi pallidi, midbrain, dorsal pons and medulla. The cerebellar white matter was specifically spared. A mitochondrial disorder was suggested. After correction of feeding problems with G-tube feeds, his high BCAAs persisted and, on fourth analysis, alloisoleucine was seen. Subsequent fibroblast enzyme and mutation analysis confirmed MSUD due to E(1)-alpha subunit deficiency. After starting dietary treatment, there was no significant improvement in his hypotonia or his psychomotor development. However, the high signal within the globi pallidi had resolved. MSUD may have diverse clinical presentations, and should be considered in children who present with chronic psychomotor delay but no acute encephalopathic episodes. BCAA levels may not be very high, alloisoleucine may not always be detected in MSUD even with severe enzyme deficiency, and imaging may be misleading if seen in the chronic phase only.
 ...
PMID:Atypical phenotype in a boy with a maple syrup urine disease. 1660 91


1 2 3 4 5 Next >>