Gene/Protein Disease Symptom Drug Enzyme Compound
Pivot Concepts:   Target Concepts:
Query: UMLS:C0026827 (hypotonia)
 5,860 document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)

We report a 16-month-old boy with psychomotor regression, muscle hypotonia, peripheral neuropathy, and lactic acidosis. Brain magnetic resonance imaging showed a bilateral abnormal signal in the substantia nigra and in the subthalamic nucleus, suggestive of Leigh disease. Histochemical analysis of skeletal muscle showed decreased cytochrome-c oxidase activity. Biochemical analysis of respiratory chain enzymes in muscle homogenate and in cultured fibroblasts showed isolated cytochrome-c oxidase deficiency. Western blot analysis in fibroblasts showed the absence of Surf1 protein. Genetic analysis of the SURF1 gene revealed that the patient was compound heterozygous for a previously reported mutation at the splice-junction site of intron 3 (240 + 1G > T), and for a novel 4-bp deletion in exon 6 (531_534delAAAT). Our data further enlarge the spectrum of mutations in SURF1 gene in patients with Leigh disease and cytochrome-c oxidase deficiency, contributing to better characterization of the clinical and neuroradiologic features of this group of patients for genotype-phenotype correlations.
 ...
PMID:A novel mutation in the SURF1 gene in a child with Leigh disease, peripheral neuropathy, and cytochrome-c oxidase deficiency. 1202 44

Two autistic children with a chromosome 15q11-q13 inverted duplication are presented. Both had uneventful perinatal courses, normal electroencephalogram and magnetic resonance imaging scans, moderate motor delay, lethargy, severe hypotonia, and modest lactic acidosis. Both had muscle mitochondrial enzyme assays that showed a pronounced mitochondrial hyperproliferation and a partial respiratory chain block most parsimoniously placed at the level of complex III, suggesting candidate gene loci for autism within the critical region may affect pathways influencing mitochondrial function.
 ...
PMID:Mitochondrial dysfunction in autistic patients with 15q inverted duplication. 1278 28

The case of a French child, born of consanguineous parents of Tunisian origin, is described. He showed a severe multisystem disease with dyserythropoietic, sideroblastic anaemia, delayed neurological development with hypotonia and convulsions, salt-losing nephropathy, chronic watery diarrhoea, lactic acidosis with mitochondrial dysfunction, brittle hair, hypergammaglobulinaemia, fatty liver with intermittent transaminasaemia, and terminal pulmonary fibrosis. Two siblings, of both sexes, were stillborn; two more lived only a short time. One sister is alive and well. SDS gel analysis of the red cell membranes showed a deficiency within 'Band 7' at 32 kDa. Analysis of the gene encoding 'stomatin', or 'erythrocyte membrane protein 7.2b', the principal protein of 'Band 7', revealed a complex series of aberrant spliceforms centred around exon 3, for which no explanatory genomic lesion could be found. The true underlying molecular cause of this condition remains obscure, but it suggests that the stomatin gene should be studied in other cases.
 ...
PMID:A family showing recessively inherited multisystem pathology with aberrant splicing of the erythrocyte Band 7.2b ('stomatin') gene. 1497 Jul 44

Rare cases of suspected spinal muscular atrophy (SMA) have been found to have cytochrome c oxidase (COX) deficiency. To date, four cases with SMA features have been reported in children with mutations in the synthesis of cytochrome oxidase 2 (SCO2) gene. We report a male neonate who was born hypotonic, with persistent lactic acidosis, spontaneous activity with EMG testing, development of respiratory distress in the first few hours of life, and died at 30 days of age with progressive cardiomyopathy. Testing for survival motor neurone (smn) and NAIP deletions were negative and a skeletal muscle biopsy showed neurogenic features with severe reductions of COX enzymatic and histochemical staining intensity. Post-mortem muscle, heart, and liver biopsies showed severe, moderate, and mild reductions in COX activity, respectively, with parallel findings in the protein content for the mitochondrial DNA (COII) and nuclear DNA (COIV) encoded subunits. DNA sequencing of exon 2 of the SCO2 gene revealed compound heterozygosity with mutations at G1541A (common mutation, E140K) and also at a novel site in the copper binding region (G1521A in the current case (converting a highly conserved cysteine to tyrosine [corrected] (C133Y) [corrected]); mother heterozygous for G1521A; and father heterozygous for G1541A). This case provides strong support that SCO2 mutations can result in neonatal hypotonia with an SMA 1 phenotype. SCO2 mutations should be screened in suspected SMA cases with normal smn mutation analysis and any one of; cardiomyopathy, lactic acidosis, or COX deficiency in muscle.
 ...
PMID:Novel SCO2 mutation (G1521A) presenting as a spinal muscular atrophy type I phenotype. 1499 43

Molecular diagnosis of mitochondrial DNA disorder is usually focused on point mutations and large deletions. In the absence of detectable mtDNA mutations, abnormal amounts of mtDNA, either depletion or elevation, can be indicative of mitochondrial dysfunction. The amount of mitochondrial DNA (mtDNA), however, varies among individuals of different ages and among different tissues within the same individual. To establish a range of mtDNA levels, we analyzed 300 muscle and 200 blood specimens from patients suspected of having a mitochondrial disorder by real-time quantitative polymerase chain reaction (PCR) method. Copy numbers were calculated from the standard curve and threshold cycle number using TaqMan probes; 6FAM 5'TTACCGGGCTCTGCCATCT3'-TAMRA and VIC-5'AGCAATAACAGGTCTGTGATG3'-TAMRA for mtDNA and 18S rRNA gene (nDNA), respectively. The copy number ratio of mtDNA to nDNA was used as a measure of mtDNA content in each specimen. The mtDNA content in muscle increases steadily from birth to about 5 years of age; thereafter, it stays about the same. On the contrary, the mtDNA content in blood decreases with age. The amount of mtDNA in skeletal muscle is about 5-20 times higher than that in blood. About 7% of patients had mtDNA levels in muscle below 20% of the mean of the age-matched group, and about 10% of patients had muscle mtDNA levels 2- to 16-fold higher than the mean of the age-matched group. Patients with abnormal levels of mtDNA, either depletion or proliferation, had significant clinical manifestations characteristic of mitochondrial disease in addition to abnormal respiratory enzymes and mitochondrial cytopathies. Cardiomyopathy, lactic acidosis, abnormal brain MRI findings, hypotonia, developmental delay, seizures, and failure to thrive are general clinical pictures of patients with mtDNA depletion. The average age of patients with mtDNA depletion is 4.1 years, compared to 23.6 years in patients with mtDNA proliferation. Mutations in nuclear genes involved in mtDNA synthesis and deoxynucleotide pools are probably the cause of mtDNA depletion. Our results demonstrate that real time quantitative PCR is a valuable tool for molecular screening of mitochondrial diseases.
 ...
PMID:Quantitative PCR analysis of mitochondrial DNA content in patients with mitochondrial disease. 1512 6

A six-day-old girl was referred for severe hepatic failure, dehydratation, axial hypotonia, and both lactic acidosis and ketoacidosis. Biotin-unresponsive pyruvate carboxylase deficiency type B was diagnosed. Triheptanoin, an odd-carbon triglyceride, was administrated as a source for acetyl-CoA and anaplerotic propionyl-CoA. Although this patient succumbed to a severe infection, during the six months interval of her anaplerotic and biochemical management, the following important observations were documented: (1) the immediate reversal (less than 48 h) of major hepatic failure with full correction of all biochemical abnormalities, (2) on citrate supplementation, the enhanced export from the liver of triheptanoin's metabolites, namely 5 carbon ketone bodies, increasing the availability of these anaplerotic substrates for peripheral organs, (3) the demonstration of the transport of C5 ketone bodies-representing alternative energetic fuel for the brain-across the blood-brain barrier, associated to increased levels of glutamine and free gamma-aminobutyric acid (f-GABA) in the cerebrospinal fluid. Considering that pyruvate carboxylase is a key enzyme for anaplerosis, besides the new perspectives brought by anaplerotic therapies in those rare pyruvate carboxylase deficiencies, this therapeutic trial also emphasizes the possible extended indications of triheptanoin in various diseases where the citric acid cycle is impaired.
 ...
PMID:Pyruvate carboxylase deficiency: clinical and biochemical response to anaplerotic diet therapy. 1578 Nov 90

Pyruvate dehydrogenase deficiency is a major cause of primary lactic acidosis and neurological dysfunction in infancy and early childhood. Most cases are caused by mutations in the X-linked gene for the E1alpha subunit of the complex. Mutations in DLAT, the gene encoding dihydrolipoamide acetyltransferase, the E2 core component of the complex, have not been described previously. We report two unrelated patients with pyruvate dehydrogenase deficiency caused by defects in the E2 subunit. Both patients are less severely affected than typical patients with E1alpha mutations and both have survived well into childhood. Episodic dystonia was the major neurological manifestation, with other more common features of pyruvate dehydrogenase deficiency, such as hypotonia and ataxia, being less prominent. The patients had neuroradiological evidence of discrete lesions restricted to the globus pallidus, and both are homozygous for different mutations in the DLAT gene. The clinical presentation and neuroradiological findings are not typical of pyruvate dehydrogenase deficiency and extend the clinical and mutational spectrum of this condition.
 ...
PMID:Clinical and genetic spectrum of pyruvate dehydrogenase deficiency: dihydrolipoamide acetyltransferase (E2) deficiency. 1604 40

3-Methylglutaconic aciduria is the biochemical marker of several inherited metabolic diseases. Four types of 3-methylglutaconic aciduria can be distinguished. In the type I form, accumulation of 3-methylglutaconate is due to deficient activity of 3-methylglutaconyl-CoA hydratase, an enzyme of the leucine degradation pathway. In the other forms, 3-methylglutaconic acid is not derived from leucine but is of unidentified origin, possibly derived from other metabolic pathways, such as mevalonate metabolism. We report five patients, all presenting a severe early-onset phenotype characterized by 3-methylglutaconic aciduria, hypertrophic cardiomyopathy, cataract, hypotonia/developmental delay, lactic acidosis, and normal 3-methylglutaconyl-CoA hydratase activity. This peculiar phenotype, for which a primary mitochondrial disorder is hypothesized, identifies a novel subtype of 3-methylglutaconic aciduria.
 ...
PMID:Hypertrophic cardiomyopathy, cataract, developmental delay, lactic acidosis: a novel subtype of 3-methylglutaconic aciduria. 1673 96

Ethylmalonic aciduria is a common finding in patients affected by short-chain acyl-CoA dehydrogenase (SCAD) deficiency and other diseases characterized by encephalopathy, muscular symptomatology, and lactic acidemia. Considering that the pathophysiological mechanisms of these disorders are practically unknown and that lactic acidosis suggest an impairment of energy production, the objective of the present work was to investigate the in vitro effect of ethylmalonic acid (EMA), at concentrations varying from 0.25 to 5.0 mM, on important parameters of energy metabolism in human skeletal muscle, such as the activities of the respiratory chain complexes and of creatine kinase, which are responsible for most of the ATP produced and transferred inside the cell. We verified that EMA significantly inhibited the activity of complex I-III at concentrations as low as 0.25 mM, complex II-III at 1 mM and higher concentrations, and complex II at the concentration of 5 mM. In contrast, complex IV was not inhibited by the acid. Finally, we observed that the activity of creatine kinase was significantly inhibited by EMA at the concentrations of 1 and 5 mM. These results suggest that EMA compromises energy metabolism in human skeletal muscle. In case the in vitro effects detected in the present study also occur in vivo, it is tempting to speculate that they may contribute, at least in part, to explain the hypotonia/myopathy, as well as the increased concentrations of lactic acid present in the patients affected by illnesses in which EMA accumulates.
 ...
PMID:Inhibition of the electron transport chain and creatine kinase activity by ethylmalonic acid in human skeletal muscle. 1677 66

We report two male Taiwanese siblings in whom the T-->C point mutation at nucleotide 9176 of the mitochondrial ATPase 6 gene (m.9176T>C mutation) was associated with early onset hypotonia, lactic acidosis, and death due to respiratory arrest at 7 and 10 months old. Brain MRI showed lesions over diffuse white matter and the bilateral posterior limbs of the internal capsule. The m.9176T>C mutation is suggested as the cause of the bilateral striatal necrosis and Leigh syndrome. However, leukodystrophy in Leigh syndrome associated with m.9176T>C mutation has never been reported before. We suggest that m.9176T>C mutation could be a new aetiology for leukodystrophy in children with Leigh syndrome.
 ...
PMID:A previously undescribed leukodystrophy in Leigh syndrome associated with T9176C mutation of the mitochondrial ATPase 6 gene. 1720 80


<< Previous 1 2 3 4 5 6 7 8 9 10 Next >>