Gene/Protein
Disease
Symptom
Drug
Enzyme
Compound
Pivot Concepts:
Gene/Protein
Disease
Symptom
Drug
Enzyme
Compound
Target Concepts:
Gene/Protein
Disease
Symptom
Drug
Enzyme
Compound
Query: UMLS:C0024530 (
malaria
)
44,886
document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)
Malaria
is a life-threatening re-emerging disease, yet it is still not clear how bloodstage malarial parasites are killed.
Nitric oxide
(NO), which has potent anti-microbial activity, may represent an important killing mechanism. The production of NO during descending Plasmodium chabaudi parasitemia, a period when parasites are killed by the immune response, supports this concept. However, NOS20/0 and NOS30/0 mice as well as mice treated with NO synthase 2 (NOS2) inhibitors do not develop exacerbated
malaria
, indicating that NO production is not necessary for the suppression of P. chabaudi parasitemia. It is possible due to the plasticity in the immune response during
malaria
that Ab-mediated immunity is enhanced in the absence of NO, thereby explaining the lack of exacerbated
malaria
in NOS-deficient mice even though NO may function in protection. However, NOS2- and B cell-deficient mice, which cannot use Ab-mediated immunity, suppress their parasitemia with a similar time course as B cell-deficient controls. C57BL/6 mice treated with Propionibacterium acnes to elicit high levels of macrophage-derived NO have a similar time course of P. chabaudi parasitemia as P. acnes-treated NOS20/0 mice, which do not produce NO; this indicates that NO is not sufficient for parasite killing. Collectively, these results indicate that NO is not necessary or sufficient to resolve P. chabaudi
malaria
.
...
PMID:Nitric oxide is neither necessary nor sufficient for resolution of Plasmodium chabaudi malaria in mice. 1097 49
Cerebral malaria depends largely on the capacity of Plasmodium falciparum infected red blood cells to adhere to the endothelia of microvessels, leading to their occlusion. The most important players include receptors expressed on the surface of the endothelial cell and known to interact with the parasite, cytokines modulating the expression of these adhesion molecules and
nitric oxide
(NO). Platelets, monocytes and lymphocytes have the ability to adhere to these endothelial receptors and to one another, leading to a more complex situation and an increase in the degree of vessel occlusion. The polymorphism of all these molecules, implicated either in adhesion, in modulation of this adhesion or activation of the expression of diverse endothelial mediators should be an important field of study. Polymorphism of five of these molecules has been explored so far: ICAM-1, TNF-alpha, IL-1-beta, inducible NOS and complement receptor-1 (CR-1). To these studies can be added those concerning mannose binding protein (MBP), a protein playing a role in innate immunity, and the class-I antigen HLA-B53. To date, the only clear cut result concerns TNF-alpha. With the other polymorphisms, either no association is found (IL-1RA, CR-1, MBP), or the results are geographically heterogeneous (ICAM-1, HLA-B53), or contradictory (iNOS2). Most often, the candidate gene approach has been followed, as part of case control studies. One of the main problems in this approach is the difficulty of establishing the control cohort. This difficulty disappears in family studies, which include their own controls. So far, the only results based on complex segregation analysis have been focused on parasite multiplication and not on cerebral
malaria
.
...
PMID:Cerebral malaria and immunogenetics. 1112 53
Hemozoin (
malaria
pigment), a polymer of hematin (ferri-protoporphyrin IX) derived from hemoglobin ingested by intraerythrocytic plasmodia, modulates cytokine production by phagocytes. Mouse peritoneal macrophages (PM) fed with synthetic beta-hematin (BH), structurally identical to native hemozoin, no longer produce tumor necrosis factor alpha (TNFalpha) and
nitric oxide
(NO) in response to lipopolysaccharide (LPS). Impairment of NO synthesis is due to inhibition of inducible nitric oxide synthase (iNOS) production. BH-mediated inhibition of PM functions cannot be ascribed to iron release from BH because neither prevention by iron chelators nor down-regulation of iron-regulatory protein activity was detected. Inhibition appears to be related to pigment-induced oxidative stress because (a) thiol compounds partially restored PM functions, (b) heme oxygenase (HO-1) and catalase mRNA levels were up-regulated, and (c) free radicals production increased in BH-treated cells. The antioxidant defenses of the cells determine the response to BH: microglia cells, which show a lower extent of induction of HO-1 and catalase mRNAs and lower accumulation of oxygen radicals, are less sensitive to the inhibitory effect of BH on cytokine production. Results indicate that BH is resistant to degradation by HO-1 and that heme-iron mediated oxidative stress may contribute to
malaria
-induced immunosuppression. This study may help correlate the different clinical manifestations of
malaria
, ranging from uncomplicated to severe disease, with dysregulation of phagocyte functions and promote better therapeutic strategies to counteract the effects of hemozoin accumulation.
...
PMID:Macrophage preconditioning with synthetic malaria pigment reduces cytokine production via heme iron-dependent oxidative stress. 1114 Jun 91
In this study, we report that infection with Plasmodium yoelii 17XL, a lethal strain of rodent
malaria
, does not result in death in the DBA/2 strain of mice. In contrast to BALB/c mice, DBA/2 mice developed significantly less parasitemia and never manifested symptoms of cerebral
malaria
(CM) on infection with this parasite. Moreover, the histological changes evident in the brain of susceptible BALB/c were absent in DBA/2 mice. Interestingly, the resistant DBA/2 mice when treated with recombinant interleukin (IL)-2, were found to develop CM symptoms and the infection became fatal by 6 to 8 days after infection. This condition was associated with an augmented interferon-gamma and
nitric oxide
production. Unexpectedly, IL-10 levels were also elevated in IL-2-treated DBA/2 mice during late stage of infection (at day 6 of infection) whereas the inverse relationship between IL-10 and interferon-gamma or
nitric oxide
was maintained in the early stage of infection (at day 3 after infection). The level of tumor necrosis factor-alpha production was moderately increased in the late phase of infection in these mice. Histology of brain from IL-2-treated mice demonstrated the presence of parasitized erythrocytes and infiltration of lymphocytes in cerebral vessels, and also displayed some signs of endothelial degeneration. Confocal microscopical studies demonstrated preferential accumulation of gammadelta T cells in the cerebral vessels of IL-2-treated and -infected mice but not in mice treated with IL-2 alone. The cells recruited in the brain were activated because they demonstrated expression of CD25 (IL-2R) and CD54 (intercellular adhesion molecule 1) molecules. Administration of anti-gammadelta mAb prevented development of CM in IL-2-treated mice until day 18 after infection whereas mice treated with control antibody showed CM symptoms by day 6 after infection. The information concerning creating pathological sequelae and death in an otherwise resistant mouse strain provides an interesting focus for the burden of pathological attributes on death in an infectious disease.
...
PMID:Cerebral malaria in mice: interleukin-2 treatment induces accumulation of gammadelta T cells in the brain and alters resistant mice to susceptible-like phenotype. 1114 89
Unmethylated CpG dinucleotides in bacterial DNA or synthetic oligodeoxynucleotides (ODNs) cause B-cell proliferation and immunoglobulin secretion, monocyte cytokine secretion, and activation of natural killer (NK) cell lytic activity and gamma interferon (IFN-gamma) secretion in vivo and in vitro. The potent Th1-like immune activation by CpG ODNs suggests a possible utility for enhancing innate immunity against infectious pathogens. We therefore investigated whether the innate immune response could protect against
malaria
. Treatment of mice with CpG ODN 1826 (TCCATGACGTTCCTGACGTT, with the CpG dinucleotides underlined) or 1585 (ggGGTCAACGTTGAgggggG, with g representing diester linkages and phosphorothioate linkages being to the right of lowercase letters) in the absence of antigen 1 to 2 days prior to challenge with Plasmodium yoelii sporozoites conferred sterile protection against infection. A higher level of protection was consistently induced by CpG ODN 1826 compared with CpG ODN 1585. The protective effects of both CpG ODNs were dependent on interleukin-12, as well as IFN-gamma. Moreover, CD8+ T cells (but not CD4+ T cells), NK cells, and
nitric oxide
were implicated in the CpG ODN 1585-induced protection. These data establish that the protective mechanism induced by administration of CpG ODN 1585 in the absence of parasite antigen is similar in nature to the mechanism induced by immunization with radiation-attenuated P. yoelii sporozoites or with plasmid DNA encoding preerythrocytic-stage P. yoelii antigens. We were unable to confirm whether CD8+ T cells, NK cells, or
nitric oxide
were required for the CpG ODN 1826-induced protection, but this may reflect differences in the potency of the ODNs rather than a real difference in the mechanism of action of the two ODNs. This is the first report that stimulation of the innate immune system by CpG immunostimulatory motifs can confer sterile protection against
malaria
.
...
PMID:Interleukin-12- and gamma interferon-dependent protection against malaria conferred by CpG oligodeoxynucleotide in mice. 1117 39
We have characterized brain cytokine expression profiles in the Plasmodium coatneyi/rhesus (Macaque mulatta)
malaria
model. Eight rhesus monkeys were included in the study; four were infected with P. coatneyi, and four were used as uninfected controls. All inoculated animals became infected. Eleven days after parasite inoculation, the rhesus monkeys were killed and tissue samples from 4 regions of the brain (cortex and white matter of the cerebrum, cerebellum, and midbrain) were collected for quantitation of mRNA expression of cytokines, adhesion molecules, and inducible nitric oxide synthetase (iNOS) by reverse transcriptase-polymerase chain reaction (RT-PCR). The expression levels of tumor necrosis actor-alpha (TNF-alpha), gamma interferon (IFN-gamma), interleukin-1-beta (IL-1beta), intercellular adhesion molecule-1 (ICAM-1) and inducible
nitric oxide
synethetase (iNOS) were highest in the cerebellum of infected animals, correlating well with pathologic observations of sequestration of parasitized erythrocytes in this region of the brain. Infected animals also had higher TNF-alpha expression levels in the cortex and IL-1beta expression levels in the cortex, white matter, and midbrain. Thus, the expression of pro-inflammatory and T helper-1 (TH-1) cytokines, adhesion molecules, and iNOS appears to predominate in the cerebellum of infected rhesus monkeys.
...
PMID:Expression of proinflammatory cytokines in four regions of the brain in Macaque mulatta (rhesus) monkeys infected with Plasmodium coatneyi. 1122 Jul 73
Iron chelation therapy of Plasmodium falciparum infection alleviates the clinical course of cerebral
malaria
in children. This study assessed the underlying mechanisms of this therapy. Cytokine stimulation of human (intestinal cell line DLD-1) or murine cells (murine macrophage cell line RAW 264.7) resulted in increased
nitric oxide
(NO) formation and decreased survival of plasmodia within cocultured human erythrocytes. The addition of desferrioxamine (DFO) before cytokine treatment increased both NO formation and parasite killing but had no effect in the presence of the inhibitor of NO formation, L-N6-(1-iminoethyl)-lysine. Moreover, peroxynitrite, which is formed after chemical reaction of NO with superoxide, appears to be the principal effector molecule for macrophage-mediated cytotoxicity toward P. falciparum, and interferon-gamma is a major regulatory cytokine for this process. The effect of DFO on the clearance of plasmodia appears to be due to enhanced generation of NO, rather than to limitation of iron availability to the parasite.
...
PMID:Regulatory interactions between iron and nitric oxide metabolism for immune defense against Plasmodium falciparum infection. 1129 71
Nitric oxide
(NO) is implicated as an integral component of the host armament against invading parasites. Strongest evidence has come from laboratory models of protozoan infections. During
malaria
, toxoplasmosis and leishmaniasis, to name just a few, the preferential production of pro-inflammatory cytokines predisposes to the increased synthesis of NO, which mediates host protection through either direct parasite killing or by limiting parasite growth. More recently, evidence has been put forward for a beneficial role of NO during helminthic infections. In the case of Schistosomiasis mansoni, for example, NO plays a role in regulation of egg-induced inflammation, preventing hepatocyte death and widespread tissue damage. In spite of these findings, rather than being the ultimate panacea, NO production requires tight control to limit cytotoxic damage to the host's own cells. Unregulated production may lead to a variety of damaging effects including alterations to normal neurological functions during cerebral
malaria
and intestinal pathology during trichinosis. In this review, I will summarize the role of NO during a number of parasitic infections, drawing on specific examples of disease caused by protozoan and metazoan parasites.
...
PMID:Nitric oxide in parasitic infections. 1151 11
It has been suggested that sequestration of parasitized red blood cells might contribute to the pathogenesis of cerebral
malaria
(CM), by hypoxia causing either: (i) compensatory vasodilatation with a resultant increase in the brain volume; or (ii) enhancing cytokine-induced
nitric oxide
(NO) production via induction of inducible NO synthase (iNOS). Available evidence suggests that cerebral oedema is the initiating and probably the most important factor in the pathogenesis of murine CM. The relevance of this model in the study of the pathogenesis of CM has been questioned. However, a closer look at published reports on both human and murine CM, in this review, suggests that the pathogenesis of the murine model of CM might reflect more closely the CM seen in African children than that seen in Asian adults. It is also proposed that the role of iNOS induction during CM is protective: that the primary purpose of iNOS induction is to inhibit the side effects of brain indoleamine 2,3-dioxygenase (IDO) induction and quinolinic acid accumulation during hypoxia.
...
PMID:The role of cerebral oedema in the pathogenesis of cerebral malaria. 1152 87
Nitrate levels in CSF and sera from 16 coma and 19 noncoma falciparum
malaria
patients were determined using
nitric oxide
colorometric assay. The medians (range lower, upper limits) of nitrate in sera of comatose and noncomatose patients were 0.28 (0.11, 1.24) and 0.23 (0.05, 0.87) microM, respectively. The medians of nitrate level in CSF of coma and noncoma cases were 0.09 (0.01, 0.28) and 0.15 (0, 1.18) microM, respectively. There was no difference of nitrate level in sera and CSF from comatose or noncomatose patients compared to that in normal sera and CSF. The amount of nitrate in sera and CSF of both groups was not significantly correlated with coma depth, parasitemia, parasite clearance time and time to recovery. Contrast to our in vitro study using immunoperoxidase staining, we found inducible nitric oside synthase production by brain endothelial cells during 4-24 hours of coculturing with late stage of P. falciparum infected red blood cells. These results suggests that
malaria
severity can not be differentiated by nitrate level in body fluid.
...
PMID:Lack of association between CSF nitrate and sera nitrate in falciparum malaria infection. 1155 75
<< Previous
1
2
3
4
5
6
7
8
9
10
Next >>