Gene/Protein Disease Symptom Drug Enzyme Compound
Pivot Concepts:   Target Concepts:
Query: UMLS:C0024141 (systemic lupus erythematosus)
 44,322 document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)

We have previously shown that continuous administration of anti-interleukin 10 (anti-IL-10) antibodies (Abs) to BALB/c mice modifies endogenous levels of autoantibodies, tumor necrosis factor alpha (TNF-alpha), and interferon gamma, three immune mediators known to affect the development of autoimmunity in "lupus-prone" New Zealand black/white (NZB/W)F1 mice. To explore the consequences of IL-10 neutralization in NZB/W F1 mice, animals were injected two to three times per week from birth until 8-10 mo of age with anti-IL-10 Abs or with isotype control Abs. Anti-IL-10 treatment substantially delayed onset of autoimmunity in NZB/W F1 mice as monitored either by overall survival, or by development of proteinuria, glomerulonephritis, or autoantibodies. Survival at 9 mo was increased from 10 to 80% in anti-IL-10-treated mice relative to Ig isotype-treated controls. This protection against autoimmunity appeared to be due to an anti-IL-10-induced upregulation of endogenous TNF-alpha, since anti-IL-10-protected NZB/W F1 mice rapidly developed autoimmunity when neutralizing anti-TNF-alpha Abs were introduced at 30 wk along with the anti-IL-10 treatment. Consistent with the protective role of anti-IL-10 treatment in these experiments, continuous administration of IL-10 from 4 until 38 wk of age accelerated the onset of autoimmunity in NZB/W F1 mice. The same period of continuous IL-10 administration did not appear to be toxic to, or cause development of lupus-like autoimmunity in normal BALB/c mice. These data suggest that IL-10 antagonists may be beneficial in the treatment of human systemic lupus erythematosus.
 ...
PMID:Continuous administration of anti-interleukin 10 antibodies delays onset of autoimmunity in NZB/W F1 mice. 827 Aug 73

We investigated serum levels of interleukin-6 (IL-6), interferon-gamma (IFN-gamma), and tumor necrosis factor alpha (TNF alpha) from patients with systemic lupus erythematosus (SLE) and its various clinical manifestations of disease and from patients with rheumatoid arthritis (RA) and other rheumatic diseases. The serum levels of IL-6 and IFN-gamma were highly elevated from patients with SLE associated with lymphadenopathy (LN) or nephrotic syndrome (NS). On the contrary, the serum levels of TNF alpha were elevated from most patients with SLE associated with thrombocytopenia (TP). However, serum levels of TNF alpha were in the normal range from patients with SLE associated with NS, LN, or central nervous system disease. Of interest, patients with SLE associated with humoral immunodeficiency disorder, hypogammaglobulinemia, had highly elevated levels of serum IL-6. The concanavalin A-stimulated mononuclear cells (MNC) of patients with SLE associated with TP secreted highly elevated levels of TNF alpha compared to other patient groups. We suggest that abnormal production of various cytokines in SLE is an intrinsic defect of MNC and the immune system that may be the key element for a variety of clinical manifestations of this disease.
 ...
PMID:Cytokine profile in systemic lupus erythematosus, rheumatoid arthritis, and other rheumatic diseases. 844 45

The purpose of this work was to the hypothesis that MHC encoded susceptibility factors for SLE lie in the TNF region. An association study was performed by analyzing 123 northern Italian SLE patients and 199 matched controls for three TNF markers: two polymorphisms in the TNFA promoter and the TNFa microsatellite. Haplotypic combinations of TNF markers were also compared in patients and controls. No significant association was observed considering either the whole SLE panel or SLE clinical and immunological subtypes. Three TNF-238/A homozygous patients were detected, while no homozygote was present in controls. The clinical and immunological phenotype of the three -238/A homozygotes suggests that the -238/AA genotype is a marker of a particular clinical subtype.
 ...
PMID:Association between polymorphisms in the TNF region and systemic lupus erythematosus in the Italian population. 881 45

The sequence of 9 DNA clones obtained from DNA-anti-DNA antibody immune complexes (IC) in 11 SLE patients was analyzed and the possible pathogenic role of the circulating DNA in SLE patients was discussed. Nucleic acid length of 9 cloned DNAs ranged from 87 to 312 base pairs(bp), with a mean length of 177 +/- 62bp, which were rich in guanine (G) + cytosine(C), CpG dinucleotide and palindromic sequences. Oligonucleotide TTTTCAATTCGAAGATGATT which contain the CpG motif in hexamer palindromic sequence segments in cloned DNA augmented the expression of ICAM-1 on the endothelial cells detected by FACS analysis and also augmented the gene expression of several cytokines such as interleukin-2, interleukin-6, interleukin-8 and tumor necrosis factor alpha. These data suggest that DNA in IC of SLE patients will augment expression of ICAM-1 on endothelial cells, resulting in exacerbation of vasculitis.
 ...
PMID:[CpG motif in DNA from immune complexes of SLE patients augments expression of intercellular adhesion molecule-1 on endothelial cells]. 899 Sep 29

One hundred and twenty-six patients with LE were studied. They were distributed as follows: 84 with DLE, 13 with SALE and 29 with SLE. Biopsies from the skin lesions were performed and submitted to DIF. Positive results were equal to 69, 61.5 and 72.4 percent of the DLE, SALE and SLE cases, respectively. These data are in accordance with the literature. IgM was the most frequently found immunoglobulin, followed by the association IgM + C3.
 ...
PMID:Direct immunofluorescence in lupus erythematosus (LE). 907 25

We investigated serum level of interferon gamma (IFN-gamma), tumor necrosis factor alpha (TNF-alpha) and interleukin 6 (IL-6) using an enzyme-linked immunosorbent assay (ELISA) in 59 patients with systemic lupus erythematosus (SLE) and 16 healthy controls. We examined a possible association between serum levels of these cytokines and SLE activity, as well as correlation between IFN-gamma concentration and the level of TNF-alpha and IL-6 and also IL-6 and TNF-alpha. TNF-alpha and IL-6 were detectable in all 59 patients and normal individuals and their level was significantly higher in SLE patients than in the control group (p < 0.001 and p < 0.02, respectively). In contrast IFN-gamma was detectable in 23 (39%) patients and in only 3 (20%) healthy individuals. We found positive correlation between serum concentration of TNF-alpha and IL-6 with SLE activity and no such correlation with IFN-gamma. We also observed positive correlation between serum levels of IFN-gamma and TNF-alpha, IFN-gamma and IL-6 as well as TNF-alpha and IL-6. In conclusion, an increase in the serum levels of TNF-alpha and IL-6 may be useful markers for SLE activity.
 ...
PMID:Association of interferon gamma, tumor necrosis factor alpha and interleukin 6 serum levels with systemic lupus erythematosus activity. 988 17

Short wavelengths of ultraviolet (UV) light are clearly harmful in systemic lupus erythematosus (SLE), but the action of long UV wavelengths in SLE is more enigmatic. In a series of animal and human studies, long-wavelength UV radiation, i.e., radiation in the ultraviolet-A1 (UVA1) range (340-400 nm), has proven effective in the treatment of SLE. Disease amelioration and a marked decrease in mortality followed ultraviolet-A (UVA) radiation (320-400 nm) of the New Zealand White/New Zealand Black mouse model of lupus. A follow-up study in the same animal suggested that the longer wavelengths (UVA1, 340-400 nm) in the UVA wave band were primarily responsible. There followed four human studies. The first three of these provided data indicating that low-dose UVA1 radiation significantly reduced constitutional symptoms, joint pain, rashes, and the systemic lupus activity measures, a validated gauge of disease activity in SLE. The fourth human study showed that the therapeutic action of low-dose UVA1 action persisted or progressed long term, a period averaging 3.4 y. UVA1 effects on DNA repair, cell-mediated immunosuppression, tumor necrosis factor alpha release, and apoptosis contrast markedly with those of ultraviolet B (UVB, 280-320 nm) radiation and afford a possible basis for the salutary action of this modality of treatment. The unique features of UVA1 wavelengths may be suited to further therapeutic use, not only in SLE but also in other immunologic disorders.
 ...
PMID:Ultraviolet A1 (340-400 nm) irradiation and systemic lupus erythematosus. 1053 14

Anti-CD4 antibodies have been recently introduced into the therapy of various autoimmune diseases, among them systemic lupus erythematosus (SLE). Their modes of action are not yet fully understood. Interference with cytokine release may be one possible mechanism. Therefore, the effects of anti-CD4 antibodies on the cytokine release of IL-6 (interleukin-6) and TNF-alpha (tumor necrosis factor alpha) were investigated in a whole blood culture system. Basal and phytohemagglutin/lipopolysaccharide (PHA/LPS)-stimulated cytokine patterns were compared to cytokine release after the addition of anti-CD4 antibodies (MAX.16H5) or methylprednisolone in short time whole blood cell culture systems from 12 patients with active SLE, 23 patients with inactive SLE and 12 healthy volunteers. TNF-alpha and IL-6 concentrations were determined in the supernatants by ELISA. High disease activity correlated with an increased production of proinflammatory cytokines. Cell cultures of patients with inactive SLE showed a diminished capacity to respond to mitogenic stimulation. Anti-CD4 antibodies added in vitro suppressed significantly the unstimulated production of IL-6 (P<0.02) in the cell cultures of patients with active SLE and in the PHA/LPS-stimulated cell cultures from both groups of SLE patients (both P<0.001) and healthy volunteers (P<0.01). However, MAX.16H5 did not affect the release of TNF-alpha. In control samples methylprednisolone considerably reduced stimulated and unstimulated IL-6 and TNF-alpha production in all SLE patients, irrespective of the disease state, and in all healthy controls. These data indicate that the proinflammatory cytokines are involved in the pathogenesis of SLE. It is assumed that anti-CD4 antibodies, which can be effective in the treatment of highly active lupus patients, may act via their influence on cytokine release. The decrease of the proinflammatory cytokines IL-6 under therapy with MAX.16H5 could explain the observations of clinical trials and animal studies which showed a reduction of inflammatory parameters and diminished production of autoantibodies following treatment with anti-CD4 antibodies.
Lupus 1999
PMID:Effects of anti-CD4 antibodies on the release of IL-6 and TNF-alpha in whole blood samples from patients with systemic lupus erythematosus. 1060 44

Systemic lupus erythematosus (SLE) is a complex autoimmune disease that exhibits extensive clinical heterogeneity. Several studies have suggested a role for tumor necrosis factor alpha (TNFalpha) in SLE and recently, the locus encompassing the TNF receptor II (TNFRII), which is a mediator of TNF effect, was amongst the candidate loci suggested by genetic linkage studies of multi-case SLE families. Komata et al. reported an association between a polymorphism at position 196 (R allele) of TNFR II and SLE in Japanese patients. We have typed SLE patients from two different ethnic populations, Spanish and UK Caucasoids, for this polymorphism using a polymerase chain reaction and restriction fragment length polymorphism (PCR-RFLP)-based technique. No significant differences in allele or genotype frequencies were found between cases and matched controls in either population. The TNFRII 196R allele does not appear to be associated with SLE susceptibility in either Spanish or UK populations.
 ...
PMID:Tumor necrosis factor receptor II (TNFRII) exon 6 polymorphism in systemic lupus erythematosus. 1070 22

Gene therapy offers advantages for the immunotherapeutic delivery of cytokines or their inhibitors. After gene transfer, these mediators are produced at relatively constant, non-toxic levels and sometimes in a tissue-specific manner, obviating limitations of protein administration. Therapy with viral or nonviral vectors is effective in several animal models of autoimmunity including Type 1 diabetes mellitus (DM), experimental allergic encephalomyelitis (EAE), systemic lupus erythematosus (SLE), colitis, thyroiditis and various forms of arthritis. Genes encoding transforming growth factor beta, interleukin-4 (IL-4) and IL-10 are most frequently protective. Autoimmune/ inflammatory diseases are associated with excessive production of inflammatory cytokines such as IL-1, IL-12, tumor necrosis factor alpha (TNFalpha) and interferon gamma (IFNgamma). Vectors encoding inhibitors of these cytokines, such as IL-1 receptor antagonist, soluble IL-1 receptors, IL-12p40, soluble TNFalpha receptors or IFNgamma-receptor/IgG-Fc fusion proteins are protective in models of either arthritis, Type 1 DM, SLE or EAE. We use intramuscular injection of naked plasmid DNA for cytokine or anticytokine therapy. Muscle tissue is accessible, expression is usually more persistent than elsewhere, transfection efficiency can be increased by low-voltage in vivo electroporation, vector administration is simple and the method is inexpensive. Plasmids do not induce neutralizing immunity allowing repeated administration, and are suitable for the treatment of chronic immunological diseases.
 ...
PMID:Gene therapy of autoimmune diseases with vectors encoding regulatory cytokines or inflammatory cytokine inhibitors. 1095 13


<< Previous 1 2 3 4 5 6 7 Next >>