Gene/Protein Disease Symptom Drug Enzyme Compound
Pivot Concepts:   Target Concepts:
Query: UMLS:C0023473 (chronic myeloid leukemia)
 18,916 document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)

Alterations in the tumor suppressor gene p53 are associated with the pathogenesis of blastic transformation of chronic myeloid leukemia (CML), but their exact role, particularly their relationship with the chimeric protein p210BCR/ABL, is poorly defined. Point mutations in p53 have been found in some cases of blast crisis and CML blastic cell lines, but it is not clear whether complete inactivation of p53 tumor suppressor function, with or without the production of a mutant protein, can by itself trigger the process of blastic transformation. By using retroviral gene transfer, we showed that the introduction of a mutant human p53 cDNA into hematopoietic progenitor cells from patients with CML in chronic phase, which already contain p210BCR/ABL, could promote their proliferation in vitro, and occasionally even lead to the growth of factor-independent colonies. We conclude that a mutant p53 may act in synergy with p210BCR/ABL and promote the survival and proliferation of CML hematopoietic stem and progenitor cells in vitro.
 ...
PMID:Retroviral transduction of Philadelphia-positive chronic myeloid leukemia cells with a human mutant p53 cDNA and its effect on in vitro proliferation. 828 58

The retinoblastoma susceptibility gene (RB) and p53 gene are now known to be the prototypes for a class of tumor suppressor genes. Both genes act as a regulator of cell cycle transition at G1/S in many types of cell lineages. Underphosphorylated form of RB protein (Rd) acts as a growth suppressor by blocking exit from G1 through a specific binding to E2F or promoter region of certain growth-associated genes. Phosphorylation of Rb can be viewed as inactivating Rb and allowing cell cycle progression to occur. Differentiation of hematopoietic cell is accompanied with the loss of ability to phosphorylate Rb, indicating that Rb plays an important role in hematopoietic cell growth and differentiation. Abnormalities of RB gene may, therefore, predispose to the development of hematologic malignancies. DNA rearrangement was reported to be present in 1.5-12.1% of cases with primary leukemias, and the absence of RB protein was also observed in 6.3-23.2%. The abnormalities of p53 gene were also frequently observed in hematologic malignancies. DNA rearrangement of p53 was observed in 20-30% of the cases with blastic crisis of CML. Point mutation at the "hot spot" was reported in many types of leukemias, especially in cell lines established from these cases.
 ...
PMID:[Tumor suppressor genes and their role in abnormal production of leukocytes (leukemogenesis)]. 831 27

We have investigated the involvement of the p53 tumor suppressor gene and RAS family proto-oncogenes in BCR/ABL-negative chronic myeloproliferative disorders (CMPD), including nine cases of myelosclerosis with myeloid metaplasia, four polycythemia vera, 10 essential thrombocythemia, one juvenile chronic myeloid leukemia, and eight BCR/ABL-negative chronic myeloid leukemia. Twenty-five samples were studied in the chronic phase, while seven samples were analyzed in the acute accelerated or blastic phase. The presence of mutations in p53 exons 5-9, as well as in N-, K-, H-Ras exons 1 and 2 (containing codons 12, 13, and 61) was tested by the polymerase chain reaction (PCR) single strand conformation polymorphism technique and by PCR direct sequencing. In addition, restriction analysis was performed to screen for gross rearrangements within the p53 locus. Alterations of the p53 tumor suppressor gene and Ras family proto-oncogenes were detected in 2/7 and 3/7 cases of acute phase BCR/ABL-negative CMPD, respectively, while consistently negative in all the chronic phase samples analyzed. These results suggest that p53 inactivation and/or Ras activation might play a role in acute transformation of BCR/ABL-negative CMPD.
 ...
PMID:Mutations in the P53 and RAS family genes are associated with tumor progression of BCR/ABL negative chronic myeloproliferative disorders. 832 Oct 46

We performed Southern-blot analysis of the p53 gene in 41 consecutive patients with typical chronic myelocytic leukemia (CML). In two of them, we were able to study cells during both the chronic and the accelerated phases. Only one of the 29 chronic-phase samples had rearrangement of the p53 gene, whereas three of the nine accelerated-phase samples and one of the five patients in blast crisis exhibited rearrangements. Gene deletion was observed in two patients, one in accelerated phase and the other in blast crisis. One patient with a nonrearranged p53 gene in chronic phase showed rearrangement after progression to the accelerated phase. On the other hand, one patient in accelerated phase exhibited rearrangements which disappeared after reversion to chronic phase with successful treatment. Our findings support the opinion that alterations of the p53 gene may play an important role in CML evolution.
 ...
PMID:p53 gene rearrangements in chronic myelocytic leukemia. 838 42

The p53 mutants 248Trp, 175His, and 281Gly fail to activate transcription mediated by p53CON element (GGACATGCCCGGGCATGTCC) or the ribosomal gene cluster element (ACGTTTGCCTTGCCTGGACTTGCCTGGCCTTGCCTT). We studied the effect of these inactive p53 mutants on the transcriptional activity of wild-type p53 by cotransfection of both wild-type and mutant p53 expression vectors into p53-null K562 chronic myelogenous leukemia cells. The p53 mutants enhanced the p53CON-mediated gene expression of wild-type p53 but decreased the wild-type p53-activated transcription mediated by ribosomal gene cluster. Thus, p53CON and ribosomal gene cluster represent distinct p53-binding elements. Furthermore, p53 mutants may affect the transcriptional activity of wild-type p53 in either a dominant positive or a dominant negative manner, depending on the binding element present.
 ...
PMID:Inactive p53 mutants may enhance the transcriptional activity of wild-type p53. 840 59

Rearrangements of the c-abl protooncogene and the bcr-gene are found in > 90% of patients in chronic phase of chronic myelogenous leukemia (CML). The molecular events leading to blast crisis, however, have not been well characterized. Gross alterations of the p53 gene have been detected in 30% of patients with blast crisis. Since point mutations in the p53 gene appear to be important in the process of transformation in many epithelial tumors, we looked for these mutations in the critical regions of the p53 gene (exons 4, 5, 6, 7, and 8). We used the polymerase chain reaction (PCR), direct sequencing, differential PCR, and single strand conformation polymorphism (SSCP) analysis to detect mutations of the p53 gene in samples from 21 patients with CML blast crisis. Two of 21 patients exhibited an intragenic deletion or rearrangement in p53. In addition, these patients were homozygous for the mutant p53 allele. No mutations were found in the p53 gene of the remaining 19 patients. However, sequencing of the CML blast crisis cell line, K562, revealed an insertion of a C at base position 956 within the fifth exon, causing a frame shift mutation and an early translational stop at codon 148. We conclude that, in contrast to solid tumors, mutations in exons 4-8 of p53 are not frequently seen in primary samples from CML blast crisis. However, deletions and/or rearrangements within the p53 gene do occur and may contribute to the progression from chronic phase to blast crisis in a limited number of patients with CML.
 ...
PMID:Genetic alterations in the p53 gene in the blast crisis of chronic myelogenous leukemia: analysis by polymerase chain reaction based techniques. 846 38

Increased incidence of p53 gene aberrations or chromosome 17p monosomy resulting from an isochromosome 17q [i(17q)] has been observed with transition of chronic myelogenous leukemia (CML) to myeloid blast crisis (BC), and in some patients with poor risk acute myeloid leukemia (AML) progressing from myelodysplastic syndrome (MDS). These data suggested that disease progression may be linked to bi-allelic inactivation of p53. Here, we report on p53 gene analyses of nine patients with CML-BC and AML who showed an i(17q) as characteristic cytogenetic anomaly. Using Southern blots, agarose gel electrophoresis and single-strand conformation polymorphism analyses of PCR products from genomic DNA and cDNA, spanning exons 4 through 9, we did not detect any structural abnormalities of the remaining p53 allele. These findings question the hypothesis that p53 gene alterations are the principal molecular event responsible for progression of CML chronic phase or MDS to i(17q)-positive CML-BC or AML, respectively.
 ...
PMID:Analysis of the p53 gene in patients with isochromosome 17q and Ph1-positive or -negative myeloid leukemia. 850 51

Molecular events associated with the transformation into blast crisis phase in Ph1-positive CML were analyzed in the present study. The 9;22 chromosomal translocation in CML generates the bcr/abl fused gene coding P210bcr/abl that has enhanced tyrosine kinase activity. In 55 CML cases, Southern and RT-PCR analysis revealed that breakpoints of the bcr gene on chromosome 22q11 were clustered in M-bcr, except for one case and no obvious difference was observed between chronic and crisis phases. However, blast crisis cells displayed enhanced the expression of bcr/abl mRNA, when compared with those in chronic phase cells. By DNA transfection and PCR analysis, the point-mutational activation of N-ras oncogene was rarely identified, and no point-mutational activation of fms gene was found in the crisis phase cases. On the other hand, 2 out of 13 crisis cases contained gross alteration of p53 anti-oncogene. Furthermore, all 4 myeloid crisis cases and K562 cells showed disappearance of the P53 transcript, and MC3 cells derived from a myeloid crisis case showed an aberrant transcript, whereas chronic phase cases, Ph1-positive ALL cell lines and lymphoid crisis cases including NALM-1 cells showed normal expression of the P53 gene. At present, the precise mechanism associated with the blastic trans-formation in CML remain to be determined. The present study suggested one possibility that a selective and progressive process of Ph1 clone with high expression of the bcr/abl gene may be involved with the transformation into non-lymphoid crisis phases from chronic phases. In addition, this progression may be accelerated by the alteration of p53 anti-oncogene, or/and rarely by the point-mutational activation of ras oncogene family.
 ...
PMID:[Molecular analysis of transformation into blast crisis in chronic myelogenous leukemia]. 850 66

We have reviewed all the relevant studies on the loss of the short arm of chromosome 17 (17p) and inactivation of the p53 gene in chronic myelogenous leukemia (CML) in an attempt to clarify their roles in the progression of CML. Loss of a 17p (hemizygous 17p) and p53 inactivation emerged as the disease progressed and were closely associated with each other. About half of the cases with loss of a 17p, however, did not show p53 inactivation. In these cases loss of a 17p preceded p53 inactivation, which suggested that either reduction of the p53 gene dosage or inactivation of another tumor-suppressor gene on 17p might contribute to the disease progression. Both loss of a 17p and p53 inactivation may serve as poor prognostic factors but the prognostic significance of the former only emerged when metaphase cells with loss of a 17p were dominant amongst the total cell population analyzed.
 ...
PMID:Chromosome 17 abnormalities and inactivation of the p53 gene in chronic myeloid leukemia and their prognostic significance. 853 12

The actual significance of the type of BCR-ABL rearrangement in chronic myeloid leukemia (CML) prognosis remains controversial. Also, the molecular events that lead to CML progression are largely unknown. We analyzed the M-BCR breakpoint position in 64 CML patients by Southern blot and correlated the molecular findings with the cytogenetic, hematologic, and clinical data. No statistically significant differences were found with respect to the clinical and hematologic data presented at diagnosis or in the median duration of chronic phase (CP) and survival between the groups of patients with 5' and 3' breakpoints. We also studied by PCR-SSCP and direct sequencing the p53 gene in patients with specimens available in both chronic phase and blast crisis. We identified p53 mutations in 17% of the blast crisis samples analyzed, whereas no abnormalities were found in CP. This finding suggests that only in a minor fraction of cases are lesions in the p53 gene involved in transformation. Given the present findings, along with previous reports, we believe that a novel mechanism to explain the heterogeneity of CML should be postulated and actively pursued, as should the identification of secondary molecular events more consistently involved in progression.
 ...
PMID:Further evidence for the lack of correlation between the breakpoint site within M-BCR and CML prognosis and for the occasional involvement of p53 in transformation. 853 22


<< Previous 1 2 3 4 5 6 7 8 9 10 Next >>