Gene/Protein Disease Symptom Drug Enzyme Compound
Pivot Concepts:   Target Concepts:
Query: UMLS:C0023473 (chronic myeloid leukemia)
 18,916 document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)

Acute myelocytic leukemias (AML) are characterized by a remarkably high incidence (approximately 30%) of point mutations affecting codons 12, 13, or 61 within ras genes. A predominant involvement of N-ras sequences has been established. Neither Philadelphia chromosome-positive chronic myelocytic leukemia nor other chronic myeloproliferative disorders show a similar frequency. However, a proportion of myelodysplastic syndromes, namely, the chronic myelomonocytic subtype (CMML) also show this molecular feature. The following is a brief discussion of the possible biologic and clinical implications of these observations.
 ...
PMID:Mutations in ras genes in myelocytic leukemias and myelodysplastic syndromes. 306 84

The p53 is a nuclear protein that is associated with normal cellular proliferation and can cooperate with Ha-ras in causing cellular transformation in vitro. Lineage association is known to exist between p53 expression and normal lymphopoiesis, but not myelopoiesis. We studied the expression of p53 using chronic myelogenous leukemia (CML) cell lines, somatic hybrids of these cells, and leukemic cells from CML patients. Lymphoid CML lines expressed both p53 mRNA and protein. We also analyzed p53 synthesis by two B-lymphoid lines from the same CML patient; cells of one line were derived from the neoplastic clone, cells of the other were derived from the normal clone. Both synthesized equal amounts of a phosphorylated p53 protein. None of the myeloid CML lines expressed detectable p53 protein and two of four expressed negligible p53 mRNA. Two other myeloid CML lines and myeloid cells from three of four patients expressed p53 mRNA. These findings suggest that expression of the gene is not regulated normally in CML. Several approaches were pursued to explore the differential expression of p53. Southern blot analyses showed no gross alterations in the p53 gene from cells of either the expressing or the nonexpressing lines. No difference in the pattern of demethylated CpG sites was noted in the region of the p53 gene in cells from K562 (myeloid p53 nonexpressor) and in BV173 (lymphoid p53 expressor). The sites of demethylation clustered in and around the p53 promoter in both cell lines. Somatic hybrids formed between a p53 mRNA nonexpressor myeloid line (K562) and the parental p53 expressor lymphoid lines (Daudi, PUT) produced p53 mRNA and protein, suggesting that p53 is a dominantly expressed protein and that lack of expression in myeloid cells is not mediated by a trans-acting negative regulatory protein. DNA transfection experiments performed using the indicator gene chloramphenicol acetyltransferase attached to promoter sequences of p53 showed that these constructs were equally activated in BV173 (p53 expressor) and K562 (p53 mRNA nonexpressor). The mechanism of p53 regulation in CML remains unclear.
 ...
PMID:p53 in chronic myelogenous leukemia. Study of mechanisms of differential expression. 328 Jul 26

It is clear that there are at least two classes of cancer-related genes. The more characterized of these are the oncogenes, whose activation appears to play a major role in human neoplasia. There are now two families of oncogenes, the myc and ras families, whose cooperation seems capable of transforming normal cells in culture to tumorigenic cells. As such, they appear to form complementation groups with immortalizing and transforming properties, respectively. Moreover, the oncogenes can be subclassified as tyrosine kinases or kinase related, GTP binding proteins, growth factors or growth factor receptors or nuclear proteins. More than 20 viral oncogenes have been identified, for which more than 30 proto-oncogenes or pseudogenes exist in the human genome. Many of these have been cloned, characterized to some extent, and mapped to particular chromosomes or regions of chromosomes. Further, more than 20 additional putative oncogenes or transforming genes have been identified by tumor DNA transfection studies or at sites of integration or translocation for which no viral transforming gene cognates exist. Oncogenes can be activated by increased or unregulated expression, increased copy number (duplication, amplification), or somatic mutation resulting in a protein with increased oncogenic potential. Examples of all of these mechanisms can be found in several specific human cancers or leukemias. The cytogenetic correlate of enhanced expression is a translocation between two chromosomes at specific breakpoints with no net loss of genetic material (e.g., increased c-myc expression resulting from the 8;14 translocation in Burkitt's lymphoma). The phenomenon of increased gene copy number can sometimes be visualized as trisomy or tetrasomy for a particular chromosome but more dramatically as the development of extrachromosomal DMs or as chromosomally integrated HSRs (e.g., the N-myc gene amplification seen in neuroblastoma). Finally, certain somatic mutations can be associated with translocations (e.g., the bcr/abl fusion product created as a result of the 9;22 translocation in chronic myelogenous leukemia), but they are more commonly submicroscopic (as characterized by point mutations in the ras gene family). Evidence is accumulating for a second class of cancer-related genes whose absence or inactivation is associated with tumorigenesis. These genes are associated at the cytogenetic level with chromosomal deletions, in which the breakpoints may be variable, but specific, common regions are consistently deleted.(ABSTRACT TRUNCATED AT 400 WORDS)
 ...
PMID:The involvement of oncogenes and suppressor genes in human neoplasia. 331 93

We surveyed 22 human hematopoietic tumors and tumor cell lines for sequences capable of transforming NIH 3T3 cells by DNA transfection. A primary human acute myelogenous leukemia, a chronic myelogenous leukemia cell line, and cell lines derived from three independent acute lymphocytic leukemias demonstrated oncogenes capable of conferring the transformed phenotype to NIH 3T3 cells through serial cycles of transfection. One of three transforming genes associated with acute lymphocytic leukemia cells (classified as thymocyte developmental stage II) was identified as the activated cellular homologue of the Kirsten murine sarcoma virus onc gene, kis, a member of the ras family of onc genes. A transforming gene, which was demonstrated to be common to several human myeloid and lymphoid tumor cells, was shown to be a distantly related member of the ras gene family. Thus, the NIH 3T3 transfection assay commonly detects related oncogenes in human hematopoietic tumor cells. Moreover, the activation of these oncogenes appears to be independent of the specific stage of cell differentiation or tumor phenotype.
 ...
PMID:Transforming genes of human hematopoietic tumors: frequent detection of ras-related oncogenes whose activation appears to be independent of tumor phenotype. 630 61

Cytogeneticists recognize that karyotypic abnormalities are associated with specific malignancies. In 1960, Nowell described the Philadelphia chromosome (Ph) and its relationship to chronic myelogenous leukemia (CML). Subsequent work in molecular genetics and biology has revealed that the Ph is a translocation that causes fusion of gene sites that code for the break cluster region (BCR) and the avian blastic leukemia (ABL) proteins. This so-called fusion protein is present in a large percentage of the patients who have CML. A related fusion protein is seen in about one third of patients with acute lymphoblastic leukemia. The BCR-ABL fusion protein results in increased tyrosine kinase activity. The mechanism of action is thought to be via signal transduction related to guanosine triphosphatase activating protein which interacts with a ras-p21 binding protein. Acute promyelocytic leukemia (APL) is associated with the cytogenetic abnormality of t(15;17). This alters the promyelocytic leukemia (PML) and the retinoic acid receptor alpha (RARA) gene sites. Two fusion proteins are the result of this cytogenetic abnormality. They are termed PML-RARA and RARA-PML. Only one, the PML-RARA, is associated with APL. The PML-RARA chimeric protein has two zinc finger-like regions. It retains the ligand binding domain of RARA. The protein called PML has some similarities with a family of proteins which are thought to fuse to proto-oncogenes and to act as transforming proteins. The role of classical cytogenetics and the added capability of molecular biology has helped to elucidate some of the potential mechanisms for the development of cancer and provided additional understanding of neoplasia. (ABSTRACT TRUNCATED AT 250 WORDS)
 ...
PMID:Cytogenetics, gene fusions, and cancer. 748 13

Normal p53 protein suppresses cell proliferation and ras oncogene-induced cell transformation. Missense mutations in the middle conserved conformational domain of p53 decrease its antiproliferation function. In this work, we studied the requirement of the NH2- and COOH-terminal regions of p53 in its antiproliferation function using two independent assays, growth of chronic myelogenous leukemia K562 cells on methylcellulose semisolid medium and ras oncogene-induced focus formation of rat fibroblast cells (Rat-1). We found that deletion of 80 or 159 amino acids from the NH2-terminus and deletion of 67 amino acids from the COOH-terminus of p53 drastically reduced the antiproliferation function of p53. However, the COOH-terminal deletion mutant is capable of binding to a p53 DNA-binding element, p53CON (GGACATGCCCGGGCATGTCC), and of activating p53CON-mediated transcription. These results suggest that p53' abilities to bind p53CON and activate transcription are not sufficient for its antiproliferation function and that p53CON-regulated genes may not be growth suppressive.
 ...
PMID:The DNA-binding and transcription-activation abilities of p53 are necessary but not sufficient for its antiproliferation function. 794 85

The process of malignant transformation can be ascribed to a series of characteristics and definable mutations of genes which encode proteins that control cell growth and differentiation. During the course of malignant transformation the cancer-related genes are altered by a variety of mechanisms including translocations, deletions, and point mutations which commonly result in the expression of aberrant proteins. Our laboratory has focused on determining the extent to which cancer-specific proteins expressed by aberrant cancer-related genes can function as tumor-specific antigens. The current paper reviews our studies with two prototype cancer-specific proteins, mutated p21ras protein and chimeric p210bcr-abl protein. Ras protooncogenes are activated by point mutation in approximately 20% of human malignancies. The mutations occur primarily at codons 12 or 61 and result in the expression of p21ras proteins with single substituted amino acids. Only a limited number of amino acid substitutions occur. Murine studies demonstrate that immunization with synthetic peptides corresponding to the mutated segment can elicit both class II restricted CD4+ helper/inducer T-cell responses and class I restricted CD8+ cytotoxic T-cell responses specific for mutated p21ras protein. In addition, the existence in vivo of tumors expressing mutated ras proteins can be detected by assaying for T-cell immunity to the mutated segment of ras protein. Preliminary human studies show that some patients with colon cancer have existent antibody responses to p21ras protein, implying the possible existence of autochthonous T-cell immunity to mutated ras proteins in those patients. In chronic myelogenous leukemia the human c-abl protooncogene from chromosome 9 is translocated to the specific breakpoint cluster (bcr) region on chromosome 22. The translocation results in the formation of a bcr-abl fusion gene that encodes at 210-kD chimeric protein. The joining region segment of chimeric bcr-abl protein is composed of a unique combination of c-abl and bcr amino acids and is expressed only by malignant cells. Studies demonstrate that immunization of mice with synthetic peptides corresponding to the joining region segment can elicit class II restricted CD4+ T-cell responses to p210bcr-abl proteins. Preliminary studies show that bcr-abl peptides can bind in the groove of both murine and human class I MHC molecules and can elicit bcr-abl peptide-specific cytotoxic T lymphocytes (CTL). Whether bcr-abl peptide-specific CTL can lyse cells expressing bcr-abl protein is a yet unknown. In summary, the results of the studies reviewed confirm that cancer-specific oncogenic proteins can serve as tumor-specific antigens.
 ...
PMID:T-cell immunity to oncogenic proteins including mutated ras and chimeric bcr-abl. 810 58

A high incidence of multiple primary neoplasms has been observed in our patients with ATL in comparison to persons with other forms of hematologic malignancy who we have observed during the past 23 years (1963-1985). Five of 15 patients with ATL (33.3 per cent) have had at least one other associated neoplasm in comparison to only 44 of 1156 patients with other forms of hematological malignancy (3.8 per cent). The incidence figures for secondary neoplasms associated with the other hematologic malignancies were 4.3 per cent (16/370) for acute non-lymphocytic leukemia (ANLL), 2.2 per cent (2/90) for acute lymphocytic leukemia (ALL), 4.8 per cent (1/21) for acute unclassifiable leukemia, 2.2 per cent (5/225) for chronic myelogenous leukemia, 4.7 per cent (2/43) for chronic lymphocytic leukemia, 5.9 per cent (8/136) for malignant monoclonal gammopathy and 3.7 per cent (10/271) for malignant lymphoma. The incidence of multiple neoplasms in patients with ATL in comparison to those with other hematological malignancies was statistically significant (p < 0.01 or p < 0.001). The neoplasms associated with ATL have been adenocarcinoma of the thyroid or stomach, and squamous cell carcinoma of the larynx, lip or lung. We identified ATL-derived factor (ADF) in the cytoplasm of the secondary neoplasms of the ATL patients by means of indirect immunofluoroscopy and immunohistochemical techniques utilizing anti-ADF antibody. We also identified ras p21 products in these neoplasms by means of p21 ras monoclonal antibody studies. The possibility that HTLV-I was the cause of the secondary neoplasms thus was investigated. HTLV-I provirus genome was not found in all the six cases of non-ATL leukemic cells of the patients with anti-HTLV-I antibodies as determined by means of Southern blot analysis utilizing pX DNA probe. These findings suggest that there is some association between ATL cells and pre-malignant cells through ADF or other unknown factors in the activation of ras oncogenes. Subsequent suppression of host immune defence mechanisms in ATL patients permits evolution of the secondary neoplasms.
 ...
PMID:Association between ATL and non-hematopoietic neoplasms. 811 27

The BCR-ABL translocation of chronic myelogenous leukemia represents a paradigm for the study of translocations that create fusion proteins. The work of many laboratories has clearly established that the BCR-ABL protein can transform cells and cause leukemias in mice. This oncogenic signal appears to involve transduction of a tyrosine kinase signal from the cytoplasm to the nucleus via intermediary proteins such as ras and myc. Although the biological effects of the BCR-ABL fusion protein are well characterized, the normal biological functions of ABL and BCR are only beginning to come to light. ABL is a nuclear tyrosine kinase which binds DNA, suggesting a possible normal role in transcription. BCR has homology to proteins which regulate membrane ruffling. Understanding the normal roles of ABL and BCR will help define the abnormal leukemogenic effects of the BCR-ABL fusion.
 ...
PMID:Molecular consequences of the BCR-ABL translocation in chronic myelogenous leukemia. 812 22

Ph+ chronic myelogenous leukemia (CML) is associated with the reciprocal translocation between chromosomes 9 and 22 culminating in the production of the chimeric p210bcr/abl protein possessing elevated protein tyrosine kinase activity relative to the normal c-abl tyrosine kinase. Our recent studies have revealed subtle differences in the growth, phenotypic and morphologic characteristics of subpopulations of primary lin- Ph+ chronic phase CML blasts and comparable primary normal blasts. In an attempt to correlate these biologic abnormalities and the presence of the p210bcr/abl protein, we initiated studies to identify differences in proteins constitutively phosphorylated on tyrosine in whole cell lysates of comparable primary early blast subpopulations derived from normal and Ph+ chronic phase CML marrows. Immunoblotting with anti-P-tyr Abs demonstrated a prominent 62 kDa phosphotyrosyl protein (pp62) constitutively present in 11/11 Ph+ chronic phase linblasts while being virtually undetectable in equivalent amounts of protein derived from 15/15 and 2/2 comparable normal and Ph-negative chronic phase blast populations, respectively. Immunoblotting with an Ab reportedly specific for the ras GTPase activating protein (GAP) associated p62 protein revealed that the pp62 present in CML blasts is not immunologically related to the former protein. Although the identity of the pp62 is presently not known, its prominent presence in chronic phase CML blasts, in which the only known molecular abnormality is putatively the p210bcr/abl protein, strongly suggests that it may be a critical p210bcr/abl substrate involved in an early stage of expansion of the Ph+ clone.
 ...
PMID:A 62-kilodalton tyrosine phosphoprotein constitutively present in primary chronic phase chronic myelogenous leukemia enriched lineage negative blast populations. 815 67


<< Previous 1 2 3 4 5 6 Next >>