Gene/Protein Disease Symptom Drug Enzyme Compound
Pivot Concepts:   Target Concepts:
Query: UMLS:C0023473 (chronic myeloid leukemia)
 18,916 document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)

Inactivation of the tumor suppressor function of the p53 gene is found in association with 20-40% cases of chronic myeloid leukemia (CML) in blast crisis. A common mechanism of p53 inactivation in CML is by complete deletion of one p53 allele in association with a point mutation which produces a mutant p53 protein on the remaining allele. Whether the mutant p53 protein, which is generally expressed at an elevated level, plays any role in the pathogenesis of blastic transformation or in maintaining the neoplastic proliferation, as it does in some solid tumors, is unknown. By using an antisense oligonucleotide approach, we investigated the cellular function of known abnormal forms of p53 protein, both mutant and truncated, expressed in CML cell lines. We found that the introduction of p53 antisense oligonucleotides can specifically inhibit the translation of the p53 mRNA. However, inhibiting p53 expression had no effect on cell proliferation, cell viability, and colony formation. There was no change in cell doubling time when the cells were maintained in serum-free medium (SFM) in the presence of antisense oligonucleotides compared with cells maintained in SFM alone. We conclude that the mutant or truncated p53 proteins expressed in the blast cells of CML have no growth-promoting effect and are not required for cell survival and proliferation. We further speculate that the loss of the tumor suppressor function of p53 might be the only mechanism by which p53 is involved in the transition from chronic phase to blast crisis.
 ...
PMID:The abnormal p53 proteins expressed in CML cell lines are non-functional. 823 Dec 51

Alterations in the tumor suppressor gene p53 are associated with the pathogenesis of blastic transformation of chronic myeloid leukemia (CML), but their exact role, particularly their relationship with the chimeric protein p210BCR/ABL, is poorly defined. Point mutations in p53 have been found in some cases of blast crisis and CML blastic cell lines, but it is not clear whether complete inactivation of p53 tumor suppressor function, with or without the production of a mutant protein, can by itself trigger the process of blastic transformation. By using retroviral gene transfer, we showed that the introduction of a mutant human p53 cDNA into hematopoietic progenitor cells from patients with CML in chronic phase, which already contain p210BCR/ABL, could promote their proliferation in vitro, and occasionally even lead to the growth of factor-independent colonies. We conclude that a mutant p53 may act in synergy with p210BCR/ABL and promote the survival and proliferation of CML hematopoietic stem and progenitor cells in vitro.
 ...
PMID:Retroviral transduction of Philadelphia-positive chronic myeloid leukemia cells with a human mutant p53 cDNA and its effect on in vitro proliferation. 828 58

The p53 mutants 248Trp, 175His, and 281Gly fail to activate transcription mediated by p53CON element (GGACATGCCCGGGCATGTCC) or the ribosomal gene cluster element (ACGTTTGCCTTGCCTGGACTTGCCTGGCCTTGCCTT). We studied the effect of these inactive p53 mutants on the transcriptional activity of wild-type p53 by cotransfection of both wild-type and mutant p53 expression vectors into p53-null K562 chronic myelogenous leukemia cells. The p53 mutants enhanced the p53CON-mediated gene expression of wild-type p53 but decreased the wild-type p53-activated transcription mediated by ribosomal gene cluster. Thus, p53CON and ribosomal gene cluster represent distinct p53-binding elements. Furthermore, p53 mutants may affect the transcriptional activity of wild-type p53 in either a dominant positive or a dominant negative manner, depending on the binding element present.
 ...
PMID:Inactive p53 mutants may enhance the transcriptional activity of wild-type p53. 840 59

Rearrangements of the c-abl protooncogene and the bcr-gene are found in > 90% of patients in chronic phase of chronic myelogenous leukemia (CML). The molecular events leading to blast crisis, however, have not been well characterized. Gross alterations of the p53 gene have been detected in 30% of patients with blast crisis. Since point mutations in the p53 gene appear to be important in the process of transformation in many epithelial tumors, we looked for these mutations in the critical regions of the p53 gene (exons 4, 5, 6, 7, and 8). We used the polymerase chain reaction (PCR), direct sequencing, differential PCR, and single strand conformation polymorphism (SSCP) analysis to detect mutations of the p53 gene in samples from 21 patients with CML blast crisis. Two of 21 patients exhibited an intragenic deletion or rearrangement in p53. In addition, these patients were homozygous for the mutant p53 allele. No mutations were found in the p53 gene of the remaining 19 patients. However, sequencing of the CML blast crisis cell line, K562, revealed an insertion of a C at base position 956 within the fifth exon, causing a frame shift mutation and an early translational stop at codon 148. We conclude that, in contrast to solid tumors, mutations in exons 4-8 of p53 are not frequently seen in primary samples from CML blast crisis. However, deletions and/or rearrangements within the p53 gene do occur and may contribute to the progression from chronic phase to blast crisis in a limited number of patients with CML.
 ...
PMID:Genetic alterations in the p53 gene in the blast crisis of chronic myelogenous leukemia: analysis by polymerase chain reaction based techniques. 846 38

Mutations of the p53 tumor suppressor are often observed in various human tumors, including blast crisis of chronic myelogenous leukemia (CML). The pattern of p53 mutations in CML shows some peculiarities compared with majority of other malignancies. In particular, the substitutions at codon 273, one of the most common p53 alterations in various tumors, are not characteristic of CML. To test whether the distinctions in the pattern of p53 mutations are connected with some peculiarities of the biological effects of different mutant proteins in leukemic cells, we obtained and analyzed a panel of human K562 cell sublines expressing various exogenous p53; human Pro156, His175, His194, Trp248, and His273, or murine temperature-sensitive (ts) Val135 that has properties of mutant protein at 37 degrees C, but shows activities of the wild-type (wt) p53 at 32 degrees C. We have found that expression of wt-p53 enhanced the dependence of cells on growth/survival factors. Incubation of sparse (< 10(5) cells per/ml) K562/Val135 cultures at 32 degrees C caused apoptosis. In media conditioned by cells of different origin (K562, colorectal carcinoma LIM1215, Rat1 fibroblasts) the p53-dependent apoptosis was inhibited. Under such conditions the expression of ts-wt-p53 was accompanied by dramatic increase in the number of cells producing specific markers of erythroid differentiation-GlycPhA and Ag-Eb. Unlike to the wt-p53, the majority of tumor-derived mutant p53 (Pro156, His175, His194) increased cell survival in low serum and decreased the number of cells expressing Glyc-PhA, CD9, CD15, and CD71 differentiation antigens. On the other hand, expression of His273-p53 caused significant augmentation in the number of CD9-positive cells and enhanced the dependence on growth/survival factors that are present in serum or conditioned media. The data obtained allow to suggest that an unusual pattern of p53 mutations in CML reflects some peculiarities of biological effects of certain mutant proteins on differentiation and viability of leukemic cells.
 ...
PMID:Distinct effects of various p53 mutants on differentiation and viability of human K562 leukemia cells. 926 86

In chronic myeloid leukaemia (CML), as with other tumour types, mutations of the p53 gene are associated with disease progression. Changes in regional methylation of DNA with CML tumour development have also been demonstrated. Methylation is one mechanism by which gene expression is controlled and the CpG sites, which are the targets of DNA methylation, are also the sites of a number of the mutations found in the p53 gene. Cells harbouring mutant p53 have been shown to accumulate further genomic and genetic aberrations and methylation which alters the conformation of DNA is also believed to play a role in genomic stability. There appears to be an interplay between p53 deregulation and changing methylation patterns with the progression of CML. The cause and effect of changes in both of these critical gene regulating, DNA repair and genomic stability factors and their deviation during the progression of CML will be discussed.
 ...
PMID:p53 mutations, methylation and genomic instability in the progression of chronic myeloid leukaemia. 932 84

During the course of a study aimed at improving antisense oligodeoxynucleotide-mediated ex vivo bone marrow purging of patients suffering from chronic myeloid leukemia (CML), the properties of a number of antisense structures intended to reduce the expression of c-myc, mutant p53, and bcr-abl mRNAs and proteins were examined. The majority of the antisense oligodeoxynucleotides were designed to be capable of directing ribonuclease H (RNase H) cleavage of their target mRNAs. Streptolysin O (SLO) reversible permeabilization was used to deliver the oligodeoxynucleotides into the CML line KYO-1. We found that the efficiency and specificity of antisense oligonucleotide-induced reductions of target protein expression depended on target protein half-life, the oligonucleotide structure, and the specific sequence within the target mRNA. Transient reductions of c-myc mRNA and protein were achieved with a chimeric methylphosphonate-phosphodiester oligodeoxynucleotide antisense to the initiation codon, but cell proliferation was unaffected. In contrast, a chimeric oligodeoxynucleotide of similar structure targeted to an alternative site in the coding region of c-myc mRNA reduced target mRNA and protein levels for over 24 hours and halted cell proliferation. Chimeric methylphosphonate-phosphodiester oligodeoxynucleotide antisense to a point mutation in KYO-1 p53 mRNA efficiently reduced target mRNA expression, but only small, transient reductions in p53 protein expression were observed. However, a chimeric methylphosphonate-phosphorothioate oligodeoxynucleotide targeted to the same site reduced p53 protein to 30% of control levels over a 48-hour period. BCR-ABL protein expression was unaffected by chimeric oligodeoxynucleotides targeted to the breakpoint in bcr-abl mRNA, even when mRNA levels at early times were substantially reduced.
 ...
PMID:The influence of target protein half-life on the effectiveness of antisense oligonucleotide analog-mediated biologic responses. 974 66

Transcriptional silencing of tumor suppressor genes by DNA methylation occurs in cancer cell lines and in human tumors. This has led to the pursuit of DNA methyltransferase inhibition as a drug target. 5-Aza-2'-deoxycytidine [5-aza-CdR (decitabine)], a potent inhibitor of DNA methyltransferase, is a drug currently in clinical trials for the treatment of solid tumors and leukemia. The efficacy of 5-aza-CdR may be related to the induction of methylation-silenced tumor suppressor genes, genomic hypomethylation, and/or enzyme-DNA adduct formation. Here, we test the hypothesis that 5-aza-CdR treatment is perceived as DNA damage, as assessed by the activation of the tumor suppressor p53. We show that 1) colon tumor cell lines expressing wild-type p53 are more sensitive to 5-aza-CdR mediated growth arrest and cytotoxicity; 2) the response to 5-aza-CdR treatment includes the induction and activation of wild-type but not mutant p53 protein; and 3) the induction of the downstream p53 target gene p21 is partially p53-dependent. The induction of p53 protein after 5-aza-CdR treatment did not correlate with an increase in p53 transcripts, indicating that hypomethylation at the p53 promoter does not account for the p53 response. It is relevant that 5-aza-CdR has shown the greatest promise in clinical trials for the treatment of chronic myelogenous leukemia, a malignancy in which functional p53 is often retained. Our data raise the hypothesis that p53 activation may contribute to the clinical efficacy and/or toxicity of 5-aza-CdR.
 ...
PMID:Activation of the p53 DNA damage response pathway after inhibition of DNA methyltransferase by 5-aza-2'-deoxycytidine. 1125 19

Chronic myelogenous leukemia (CML) is a stem cell disorder that eventually progresses to a blast crisis phase (BC) characterized by distorted apoptotic pathways. The exact mechanism leading to failure in apoptotic pathways during CML progression is unclear. In view of the central role of p53 and apaf1 in the apoptotic machinery we examined six human paired chronic and BC phases samples for their expression. Real-time PCR (RQ-PCR) experiments showed an elevation of p53 mRNA in all patients during transition to BC. However, elevation of apaf1 during BC was observed in five patients only. In contrast, one patient displayed a significant 11.5-fold reduction of apaf1 expression during the transition to BC. No apaf1 promoter methylation was observed. The reduced apaf1 expression was accompanied by a trans-dominant point mutation (H179R) in one p53 allele and the loss of the other. This mutant p53, when tested using functionality assays, was unable to activate apaf1, consequently explaining the reduced expression observed in this patient. Furthermore, the same mutant failed to activate either genes involved in apoptotic or cell cycle arrest pathways, and can be considered as a complete loss of function mutation. This specific mutation was reported in several types of cancer, but was not implicated in CML. To conclude, in this study we have demonstrated mRNA elevation of p53 and apaf1 during CML blast crisis, indicating that genes and proteins involved in cellular apoptosis might be involved in disease progression/response to therapy. Moreover, the mutated p53 discovered in the patient exhibiting lowered apaf1 expression provides, in a clinical case, the first correlation between p53 and apaf1 transcription regulation in humans.
 ...
PMID:Apaf1 in chronic myelogenous leukemia (CML) progression: reduced Apaf1 expression is correlated with a H179R p53 mutation during clinical blast crisis. 1736 Oct 96

The scaffold protein spinophilin (SPN) is a regulatory subunit of phosphatase 1a (PP1a) located at 17q21.33. This region is frequently associated with microsatellite instability and LOH and contains a relatively high density of known tumor suppressor genes, and several unidentified candidate tumor suppressor genes located distal to BRCA1. Spn is located in this locus and proposed to be a new tumor suppressor. Loss of Spn induces a proliferative response by increasing pRb phosphorylation, which in turn activates p53, thereby, neutralizing the proliferative response. The absence of p53 bypasses this barrier and enhances the malignant phenotype. Furthermore, the ectopic expression of SPN in human tumor cells from different types of malignancies greatly reduced cell growth. Spn knock-out mice had decreased lifespan with increased cellular proliferation in tissues such as the mammary ducts and early appearance of tumors. Furthermore, the combined loss of Spn and mutant p53 activity led to increased mammary carcinomas, confirming the functional relationship between p53 and Spn. In human tumors, Spn is absent in 20% and reduced in another 37% of human lung tumors. Spn reduction correlates with malignant grade and p53 mutations. Furthermore, Spn mRNA is lost in a percentage of renal carcinomas and lung adenocarcinomas. Finally, lower levels of Spn mRNA correlate with higher grade of ovarian carcinoma and chronic myelogenous leukemia. Therefore, Spn may be the tumor suppressor gene that is located at 17q21.33 and that its tumor suppressive function is dependent on the absence of p53.
 ...
PMID:Spinophilin: a new tumor suppressor at 17q21. 2251 82


1 2 Next >>