Gene/Protein Disease Symptom Drug Enzyme Compound
Pivot Concepts:   Target Concepts:
Query: UMLS:C0023473 (chronic myeloid leukemia)
18,916 document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)

CD46, until recently known as HuLy-m5, is a non-lineage restricted surface antigen ubiquitously expressed by almost all human cells except erythrocytes. The CD46 antigen is identified by the E4.3 monoclonal antibody (mAb) and exists at the surface of human peripheral blood lymphocytes (PBLs) as two acidic, non-disulfide bonded chains, alpha and beta, of Mr 66,000 and 56,000. Receptor density analysis showed that CD46 was of moderately low abundance on PBLs with 7.5 x 10(3) molecules present on each cell. The two chains of CD46 were purified (144,000-fold) by immunoaffinity-chromatography with E4.3 mAb from the plasma membranes of a human spleen infiltrated with chronic myelogenous leukemia cells. Amino acid sequence analysis of the NH2-terminal of both alpha and beta chains yielded the same sequence; XEEPPQ/TFEAMELIGKPKPYYEIGE. Peptide mapping studies confirmed that both CD46 chains were closely related, except for one peptide fragment. This amino acid sequence is identical to that of the NH2-terminal of the recently cloned membrane co-factor protein (MCP), a membrane protein that binds the C3b and C4b fragments of complement and acts as a co-factor for I protein-mediated decay of the complement convertases. CD46 shares a cross-reactive epitope with some primate retroviruses, and this may indicate that some retroviruses mimic the mechanisms used by autologous human cells to evade complement-mediated immune clearance.
...
PMID:Human non-lineage antigen, CD46 (HuLy-m5): purification and partial sequencing demonstrates structural homology with complement-regulating glycoproteins. 229 62

The v-abl oncogene of the Abelson murine leukemia virus (A-MuLV) is known to efficiently transform NIH/3T3 fibroblasts in vitro and to cause an acute lymphosarcoma in susceptible murine hosts. The role of its relative, the bcr/abl gene product, in the etiology of human chronic myelogenous leukemia (CML) remains speculative. To assess the transforming properties of the bcr/abl gene product, complementary DNA clones encoding the CML-specific P210 bcr/abl protein were expressed in NIH/3T3 fibroblasts. In contrast to the v-abl oncogene product P160, the P210 bcr/abl gene product did not transform NIH/3T3 cells. Cell lines were isolated that expressed high levels of the P210 bcr/abl protein but were morphologically normal. During the course of these experiments, a transforming recombinant of bcr/abl was isolated which fuses gag determinants derived from helper virus to the NH2-terminus of the bcr/abl protein. This suggests that a property of viral gag sequences, probably myristylation-dependent membrane localization, must be provided to bcr/abl for it to transform fibroblasts.
...
PMID:The CML-specific P210 bcr/abl protein, unlike v-abl, does not transform NIH/3T3 fibroblasts. 244 Jan 7

We have isolated and sequenced a cDNA clone encoding the mouse LAMP-1 (mLAMP-1) major lysosomal membrane glycoprotein. The deduced protein sequence, which included the NH2-terminal portion of the mLAMP-1 molecule, consisted of 382 amino acids (Mr 41,509). The predicted structure of this protein included an NH2-terminal intralumenal domain consisting of two homology units of approximately 160 residues each separated by a proline-rich hinge region. Each homology unit contained four cysteine residues with two intercysteine intervals of 36-38 residues and one of 68 or 76 residues. The molecule also contained 20 asparagine-linked glycosylation sites within residues 1-287, a membrane-spanning region from residues 347 to 370, and a carboxyl-terminal cytoplasmic domain of 12 residues. The biochemical properties and amino acid sequence of mLAMP-1 were highly similar to those of two other molecules that have been studied as cell surface onco-differentiation antigens: a highly sialylated polylactosaminoglycan-containing glycoprotein isolated from human chronic myelogenous leukemia cells (Viitala, J., Carlsson, S. R., Siebert, P. D., and Fukuda, M. (1988) Proc. Natl. Acad. Sci. U.S.A. 85, in press) and the mouse gp130 (P2B) glycoprotein, in which an increase in beta 1-6 branching of asparagine-linked oligosaccharides has been correlated with metastatic potential in certain tumor cells (Dennis, J.W., Laferte, S., Waghorne, C., Breitman, M.L., and Kerbel, R.S. (1987) Science 236, 582-585).
...
PMID:Isolation and sequencing of a cDNA clone encoding lysosomal membrane glycoprotein mouse LAMP-1. Sequence similarity to proteins bearing onco-differentiation antigens. 337 44

The receptor on human neutrophils (polymorphonuclear leukocytes or PMN) that mediates cellular adherence has been purified from the peripheral blood PMN obtained from an individual with chronic myelogenous leukemia (CML). This receptor consists of two noncovalently associated subunits, designated alpha M (Mac-1 alpha, CD11b) (Mr = 170,000) and beta (Mac-1 beta, CDw18) (Mr = 100,000), respectively, which are identical on normal and CML PMN. The subunits were purified by monoclonal antibody 60.1-Sepharose (anti-alpha M) affinity chromatography and separated in 5-nmol quantities by high pressure liquid chromatography on a TSK-4000 gel filtration column. Subunits were characterized by amino acid composition, NH2-terminal amino acid sequence, and carbohydrate content. The NH2-terminal sequence of the human PMN alpha M subunit contains regions of homology with the human platelet glycoprotein IIb alpha. We conclude that nanomole amounts of individual alpha M and beta subunits of the receptor on human PMN that mediates cellular adherence can be isolated and separated using CML PMN.
...
PMID:Isolation and characterization of the receptor on human neutrophils that mediates cellular adherence. 355 80

Chronic myelogenous leukemia evolves in two clinically distinct stages: a chronic and a blast crisis phase. The molecular changes associated with chronic phase to blast crisis transition are largely unknown. We have identified a cDNA clone, DR-nm23, differentially expressed in a blast-crisis cDNA library, which has approximately 70% sequence similarity to the putative metastatic suppressor genes, nm23-H1 and nm23-H2. The deduced amino acid sequence similarity to the proteins encoded by these two latter genes is approximately 65% and includes domains and amino acid residues (the leucine zipper-like and the RGD domain, a serine and a histidine residue in the NH2- and in the COOH-terminal portion of the protein, respectively) postulated to be important for nm23 function. DR-nm23 mRNA is preferentially expressed at early stages of myeloid differentiation of highly purified CD34+ cells. Its constitutive expression in the myeloid precursor 32Dc13 cell line, which is growth-factor dependent for both proliferation and differentiation, results in inhibition of granulocytic differentiation induced by granulocyte colony-stimulating factor and causes apoptotic cell death. These results are consistent with a role for DR-nm23 in normal hematopoiesis and raise the possibility that its overexpression contributes to differentiation arrest, a feature of blastic transformation in chronic myelogenous leukemia.
...
PMID:Overexpression of DR-nm23, a protein encoded by a member of the nm23 gene family, inhibits granulocyte differentiation and induces apoptosis in 32Dc13 myeloid cells. 763 9

Normal p53 protein suppresses cell proliferation and ras oncogene-induced cell transformation. Missense mutations in the middle conserved conformational domain of p53 decrease its antiproliferation function. In this work, we studied the requirement of the NH2- and COOH-terminal regions of p53 in its antiproliferation function using two independent assays, growth of chronic myelogenous leukemia K562 cells on methylcellulose semisolid medium and ras oncogene-induced focus formation of rat fibroblast cells (Rat-1). We found that deletion of 80 or 159 amino acids from the NH2-terminus and deletion of 67 amino acids from the COOH-terminus of p53 drastically reduced the antiproliferation function of p53. However, the COOH-terminal deletion mutant is capable of binding to a p53 DNA-binding element, p53CON (GGACATGCCCGGGCATGTCC), and of activating p53CON-mediated transcription. These results suggest that p53' abilities to bind p53CON and activate transcription are not sufficient for its antiproliferation function and that p53CON-regulated genes may not be growth suppressive.
...
PMID:The DNA-binding and transcription-activation abilities of p53 are necessary but not sufficient for its antiproliferation function. 794 85

The phosphorylation of proteins at tyrosine residues is critical in cellular signal transduction and neoplastic transformation. These mechanisms are regulated by the activities of both protein-tyrosine kinases and protein-tyrosine phosphatases. Recent studies have identified a novel protein-tyrosine phosphatase, termed Syp, that is widely expressed in various tissues. Syp encodes a cytoplasmic phosphatase that contains two Src homology 2 (SH2) domains. Since SH2 domains have been shown to target the association of signal-transducing molecules to activated tyrosine kinases, experiments were performed to determine whether Syp might form specific complexes with p210bcr-abl, a fusion protein believed to be involved in the pathogenesis of chronic myelogenous leukemia and, thus, possibly alter or mediate p210bcr-abl tyrosine kinase activity. We found that Syp was highly and constitutively tyrosine phosphorylated in three different murine cell lines transfected with a p210bcr-abl expression vector. Furthermore, p210bcr-abl, Syp, and Grb2 formed stable complexes in BCR-ABL-expressing cells. Complex formation between p210bcr-abl and Syp was mediated in vitro by the NH2-terminal SH2 domain of Syp. Last, p210bcr-abl tyrosine kinase was effectively dephosphorylated by Syp in vitro. These results suggest an interaction between Syp and BCR-ABL protein, which might play a role in cellular transformation of BCR-ABL.
...
PMID:SH2-containing phosphotyrosine phosphatase Syp is a target of p210bcr-abl tyrosine kinase. 819 76

A novel type II integral membrane protein has been identified in the course of screening for genes overexpressed in a mouse model of chronic myelogenous leukemia blast crisis. This new protein, designated NKCL, consists of a 210-amino acid polypeptide with a short, NH2-terminal cytoplasmic tail of 17 amino acids preceding a transmembrane domain and a COOH-terminal extracellular region. The COOH-terminal 132 amino acids bear typical features of the C-type animal lectin carbohydrate-recognition domain. The Nkcl gene is unique in that it maps just proximal to the region of the genome that encodes group V members of the C-type animal lectin family near the natural killer gene complex on mouse chromosome 6, but its protein product also has features of several group II C-type animal lectins. Most notably, it has a complete Ca2+-binding site 2, which forms part of the sugar-binding site in other members of the family, and binds mannose in a Ca2+-dependent manner. Moreover, its expression is not restricted to natural killer cells, as reported for the majority of group V lectins. Nkcl is expressed in pluripotent myeloid precursors, precursor and mature macrophages, and neutrophils.
...
PMID:Characterization of a novel receptor that maps near the natural killer gene complex: demonstration of carbohydrate binding and expression in hematopoietic cells. 1036 96

The c-Fes protein-tyrosine kinase exhibits strong expression in myeloid hematopoietic cells. Previous studies have shown that Fes induces differentiation in the chronic myelogenous leukemia-derived cell line K-562, suggesting that the Fes signal for differentiation is dominant to the Bcr-Abl signal for transformation in these cells. In addition, Fes has been shown to associate with and phosphorylate Bcr on NH2-terminal sequences retained within Bcr-Abl. To determine whether Fes interacts directly with Bcr-Abl, kinase-inactive Bcr-Abl was coexpressed with Fes in 293T cells, and phosphorylation was assessed by anti-phosphotyrosine immunoblotting. Bcr-Abl was strongly phosphorylated by Fes under these conditions, suggestive of direct interaction. Similarly, tyrosine phosphorylation of kinase-inactive Fes was observed after coexpression with active Bcr-Abl. To test for the interaction of Fes with Bcr-Abl under physiological conditions, wild-type and kinase-defective Fes were stably expressed in the cytokine-dependent myeloid leukemia cell line, DAGM. Expression of either form of Fes alone did not affect the proliferation or interleukin 3 dependence of these cells. The DAGM/Fes cells were then infected with Bcr-Abl retroviruses, and their rates of cytokine-independent outgrowth were compared. Fes dramatically suppressed Bcr-Abl-induced DAGM cell outgrowth relative to a cell line expressing beta-galactosidase as a negative control. This effect required Fes tyrosine kinase activity, because the kinase-inactive form of Fes did not affect Bcr-Abl-induced cell outgrowth. The phosphotyrosine content of both wild-type and kinase-inactive Fes was strongly enhanced after coexpression with Bcr-Abl in DAGM cells, similar to the 293T result. Phosphorylation of wild-type Fes correlated with stimulation of Fes tyrosine kinase activity in the presence of Bcr-Abl. These results show that Fes and Bcr-Abl interact in myeloid cells, leading to Fes activation and suppression of Bcr-Abl-induced conversion to cytokine independence.
...
PMID:The c-Fes protein-tyrosine kinase suppresses cytokine-independent outgrowth of myeloid leukemia cells induced by Bcr-Abl. 1070 30

Incubation of bovine aortic endothelial cells (BAECs) with erythrocytes from patients with type 2 diabetes induced an increase in endothelin 1 (ET-1) production. The effect of erythrocytes on ET-1 synthesis was dependent on glycemic control. ET-1 levels after incubation with erythrocytes derived from patients with HbA(1c) levels <6% were just half the levels observed after incubation with erythrocytes from patients with HbA(1c) levels >8%. Nepsilon-(carboxymethyl)lysine (CML)-containing protein isolated from patients' erythrocytes induced ET-1, and CML-containing protein-dependent ET-1 induction was blocked by the recombinant decoy peptide soluble receptor for advanced glycation end products (AGEs), which comprises the NH2-terminal Ig domain of the receptor for AGEs. In vitro-generated AGEs induced ET-1 mRNA transcription (nuclear run-on assay and Northern blot) in a time- and dose-dependent manner. Transient transfection of BAECs with a chimeric construct containing the 5' promoter region of the ET-1 gene linked to a reporter gene confirmed that AGE induced ET-1 promoter activity. Electrophoretic mobility shift assay confirmed AGE-inducible binding of members of the nuclear factor-kappab (NF-kappaB) family to a potential binding site at -2,090 bp. Binding was functionally significant because overexpression of the cytoplasmic inhibitor of NF-kappaB or deletion of the NF-kappaB binding site reduced ET-1 induction, whereas overexpression of NF-kappaB p65 induced ET-1 even in the absence of AGEs. Thus, ET-1 transcription is controlled by the AGE-inducible redox-sensitive transcription factor NF-kappaB.
...
PMID:Endothelin 1 transcription is controlled by nuclear factor-kappaB in AGE-stimulated cultured endothelial cells. 1096 41


1 2 3 Next >>