Gene/Protein
Disease
Symptom
Drug
Enzyme
Compound
Pivot Concepts:
Gene/Protein
Disease
Symptom
Drug
Enzyme
Compound
Target Concepts:
Gene/Protein
Disease
Symptom
Drug
Enzyme
Compound
Query: UMLS:C0023418 (
leukemia
)
93,477
document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)
B-cell chronic lymphocytic leukemia (B-CLL) is a hematologic malignancy characterized by the proliferation and accumulation of mature-looking B lymphocytes. Patients with B-CLL exhibit a number of immune defects including: auto-antibodies, depressed cell-mediated immunity and hypogammaglobulinemia (HG). We investigated the control of Ig production in the malignant CLL B-cell at a transcriptional and translation level. We isolated fresh leukemic B-cells from CLL patients and analyzed for the presence of nuclear factors OCT-1, OCT-2, and NF-KB. Malignant B-cells were purified to greater than 90% B-cells, and total cellular RNA and nuclear proteins were isolated from these cells. Mobility shift assays were probed with 32P-labeled oligonucleotides specific to the immunoglobulin (Ig) enhancer and promotor regions. We detected endogenous OCT-1, OCT-2, and NF-KB in all patients tested (n = 5). We then evaluated whether activation of CLL B cells could augment kappa-mRNA levels. CLL cells (n = 3) exposed to phorbol ester and A23187 were harvested at 0, 2, 4, 8, and 48 min and examined for kappa-mRNA by Northern blot. All CLL patients (n = 3) had easily detectable levels of endogenous kappa-mRNA. However, only one patient had an obvious increase in kappa-mRNA post-induction with TPA/A23187. There was no concomitant increase in this patient's OCT-1, OCT-2, or NF-KB level. This finding prompted us to survey other B-CLL patients (n = 6) for Ig nuclear transcriptional factors pre- and post-induction. In summary, CLL B cells express Ig
transcriptional factor
OCT-1, OCT-2, and NF-KB constitutively. The endogenous level of NF-KB may account for the basal kappa-mRNA detected in B-CLL cells. However, the inability to augment NF-KB levels may, in part, explain the low levels of Ig synthesis in CLL B-cells.
Leukemia
1992 Jul
PMID:B-chronic lymphocytic leukemia cells contain both endogenous kappa immunoglobulin mRNA and critical immunoglobulin gene activation transcription factors. 848 33
A series of 5' deletion test plasmids harboring promoter sequences of the HLA-DQ beta gene fused to the bacterial chloramphenicol acetyl transferase (CAT) gene were constructed. Transient CAT expression from these constructs in several types of cells was employed to examine the role of the promoter sequence in the regulation of DQ beta gene expression. The DQ beta constructs drove CAT expression in Raji cells (human Burkitt lymphoma cells) to at least 25-fold or 50-fold higher levels than in Hela cells (human cervical carcinoma cells) or Jurkat cells (human T-
leukemia
cells), respectively. A short promoter sequence of -160 bp containing the conserved X and Y sequences was sufficient for expression in Raji cells, and deletion to -106 bp which interrupted the X sequence abolished the expression. Sequences further upstream to -160 bp as far as -2500 bp which included an Ig-like octamer appeared to have no effect on expression in Raji cells. Thus, the promoter up to -160 bp has all of the sequences required for B cell specific expression of CAT in this assay. CAT expression from the 5' deletion constructs introduced into RJ2.2.5 and 6.1.6 cells (class II-negative mutant B cells lines) was also examined. None of the 5' deletion constructs, including that with -160 bp of promoter, showed CAT expression in these cells, suggesting that a
transcriptional factor
(s) required for the activity of the DQ beta promoter was missing in these cells. Moreover, the -160 to -66 bp sequence (including the X and Y elements), which functions as a B cell specific enhancer, was inactive in the mutant cells. Thus, the missing factor(s) are required for the enhancer function of this fragment.
...
PMID:Studies of expression of the DQ beta promoter and its 5' deletion derivatives in normal and mutant human B cell lines. 251 Mar 65
The trans activator (p40tax) of human T-cell
leukemia
virus type I (HTLV-I) is a
transcriptional factor
that activates the long terminal repeat (LTR) of HTLV-I and interleukin-2 receptor alpha. We examined the HTLV-I enhancer responsible for tax-mediated trans activation and identified (A/T)(G/C)(G/C)CNNTGACG(T/A) as a plausible tax-responsive element (TRE). The putative TRE in the LTR was found to be different from the elements required for activation by cycle AMP and 12-O-tetradecanoylphorbol-13-acetate, although these elements overlapped each other. The TRE was also different from a binding site of an NF-kappa B-like factor that was identified in the interleukin-2 receptor alpha promoter and human immunodeficiency virus LTR as a TRE. The latter result was further demonstrated by the failure of the NF-kappa B sequence to compete with the TRE of the LTR in a protein-binding assay. These findings indicate that tax function and its cascade can modulate activities of various enhancer sequences, which are probably regulated by distinct DNA-binding factors.
...
PMID:A unique enhancer element for the trans activator (p40tax) of human T-cell leukemia virus type I that is distinct from cyclic AMP- and 12-O-tetradecanoylphorbol-13-acetate-responsive elements. 254 1
The trans-acting
transcriptional factor
p40tax of human T-cell
leukemia
virus type I (HTLV-I) can activate expression not only of its own viral genes but also of other viral and cellular genes. We examined the cis-acting sequences in the simian virus 40 (SV40) enhancer required for its activation by HTLV-I p40tax. Experiments with chloramphenicol acetyltransferase constructs bearing the SV40 enhancer elements revealed that p40tax-dependent transactivation of the SV40 enhancer is mediated through the C element that contains the typical sequence for binding of a nuclear factor NF-kappa B. Activation of the C element by p40tax was seen in a limited set of cell lines as was also seen with the whole enhancer of SV40. Binding of NF-kappa B or NF-kappa B-like factor to the SV40 C element increased when p40tax was expressed. The fact that HTLV-I p40tax utilizes a cellular regulatory mechanism to transactivate the SV40 enhancer in a cell-dependent manner may have implications for the pathogenesis of adult T-cell
leukemia
.
...
PMID:Cell line-dependent response of the enhancer element of simian virus 40 to transactivator p40tax encoded by human T-cell leukemia virus type I. 255 45
Human T-cell
leukemia
virus type I (HTLV-I) is the etiological agent of adult T-cell
leukemia
. The 3' end of HTLV-I proviral DNA encodes the synthesis of two regulatory proteins, tax and rex. The 40-kDa tax protein is a nuclear protein which positively stimulates transcription from the U3 region of the viral long terminal repeat sequence. Three 21-base pair sequences in the U3 region have been found to serve as the cis-element for tax-mediated trans-activation. We now report that the tax protein can trans-activate HTLV-I LTR in the absence of de novo cellular protein synthesis. Saturated mutagenesis of the 21-base pair repeat sequence showed that specific mutations clustered in sequences homologous to the cAMP responsive element (TGACGTCA) abolish trans-activation by tax. Furthermore, although the TGACGTCN element is nearly palindromic, the mutations that abolish trans-activation are localized exclusively in the 5' 6 bases, suggesting the orientation of this element may play a role in transcription. That the purified tax protein does not bind the 21-base pair repeats or nonspecific DNA lends further support to the notion that tax protein does not directly interact with the 21-base pair repeats to activate transcription. Instead, tax most likely acts via cellular
transcriptional factor
(s) to bring about trans-activation.
...
PMID:HTLV-I tax gene product activates transcription via pre-existing cellular factors and cAMP responsive element. 276 59
The cis-acting regulatory sequence of transcription from long terminal repeats (LTRs) of human T-cell
leukemia
virus type I and type II (HTLV-I and HTLV-II), which is essential for action of the virally encoded trans-acting
transcriptional factor
(s) designated pX(s), in HTLV-I and -II was identified. Deletion of most of the U3 region of the HTLV-I LTR resulted in loss of trans-acting transcriptional activation. However, when a tandem repeat of a 21-nucleotide sequence (GAAGGCTCTGACGTCTCCCCC) that is present in the U3 region of HTLV-I and -II LTRs was inserted into the deleted U3 region of the HTLV-I LTRs, chloramphenicol acetyltransferase activity was restored. The extent of restoration of activity was proportional to the number of copies of the sequence inserted. To test the possibility that the 21-nucleotide sequence alone is necessary for trans-activation, a sequence (AGGAACTGAAA) homologous to a type-specific viral enhancer sequence and present in the U3 region of HTLV-II LTR, but not in the same region of the HTLV-I LTR, was inserted together with the 21-nucleotide sequence into the deleted U3 region of the HTLV-I LTR. However, no significant differences of the levels of activities of those LTRs compared to the LTRs with only the 21-nucleotide sequence repeats were observed.
...
PMID:Requirement of multiple copies of a 21-nucleotide sequence in the U3 regions of human T-cell leukemia virus type I and type II long terminal repeats for trans-acting activation of transcription. 302 80
A novel cellular gene,
SFA-2
, was isolated by differential hybridization of a cDNA library, using probes obtained from an adult T-cell
leukemia
cell line in comparison with normal CD4+ T cells and MOLT-4 cell line. The mRNA of the
SFA-2
gene is approximately 0.9-kb in size and encodes a protein of 125 amino acids, containing a basic region-leucine zipper DNA-binding domain. The N-terminal region of
SFA-2
is rich in serine and contains a consensus sequence for casein kinase II phosphorylation. The
SFA-2
gene was strongly expressed in mature T and B lymphocytes, and was up-regulated after transformation by human T-cell
leukemia
virus type I. The
SFA-2
did not homodimerize efficiently but formed heterodimer preferentially with c-Jun. The
SFA-2
/c-Jun heterodimer bound preferentially to the AP-1 and CRE sites.
...
PMID:SFA-2, a novel bZIP transcription factor induced by human T-cell leukemia virus type I, is highly expressed in mature lymphocytes. 863 63
Human immunodeficiency virus (HIV) type 2, the second AIDS-associated human retrovirus, differs from HIV-1 in its natural history, infectivity, and pathogenicity, as well as in details of its genomic structure and molecular behavior. We report here that HIV-2 inhibits the replication of HIV-1 at the molecular level. This inhibition was selective, dose-dependent, and nonreciprocal. The closely related simian immunodeficiency provirus also inhibited HIV-1. The selectivity of inhibition was shown by the observation that HIV-2 did not significantly downmodulate the expression of the unrelated murine
leukemia
virus; neither did the murine
leukemia
virus markedly affect HIV-1 or HIV-2 expression. Moreover, while HIV-2 potently inhibited HIV-1, the reverse did not happen, thus identifying yet another and remarkable difference between HIV-1 and HIV-2. Mutational analysis of the HIV-2 genome suggested that the inhibition follows a complex pathway, possibly involving multiple genes and redundant mechanisms. Introduction of inactivating mutations into the structural and regulatory/accessory genes did not render the HIV-2 provirus ineffective. Some of the HIV-2 gene defects, such as that of tat and rev genes, were phenotypically transcomplemented by HIV-1. The HIV-2 proviruses with deletions in the putative packaging signal and defective for virus replication were effective in inducing the suppressive phenotype. Though the exact mechanism remains to be defined, the inhibition appeared to be mainly due to an intracellular molecular event because it could not be explained solely on the basis of cell surface receptor mediated interference. The results support the notion that the inhibition likely occurred at the level of viral RNA, possibly involving competition between viral RNAs for some
transcriptional factor
essential for virus replication. Induction of a cytokine is another possibility. These findings might be relevant to the clinical-epidemiological data suggesting that infection with HIV-2 may offer some protection against HIV-1 infection.
...
PMID:Human immunodeficiency virus (HIV) type 2-mediated inhibition of HIV type 1: a new approach to gene therapy of HIV-infection. 863 95
Treatment of human
leukemia
HL-60 cells with ceramide, a breakdown product of sphingomyelin, induced both programmed cell death ("apoptosis"), and cellular differentiation. Apoptosis in response to ceramide occurred in a concentration-dependent manner. Apoptosis induced by ceramide in HL-60 cells requires the presence of c-jun protooncogene. However apoptosis is inhibited by curcumin, a specific inhibitor of c-jun/AP-1. Whereas curcumin restores ability of inhibited cells to grow, it does not affect ceramide-induced differentiation. These results indicate that ceramide controls cell differentiation and proliferation through apoptosis by activating the nuclear
transcriptional factor
AP-1. Further, AP-1 is apparently more closely related to apoptosis-inducing signal transduction pathway than to the pathway leading to cellular differentiation.
...
PMID:Interrelation of differentiation, proliferation and apoptosis in cancer cells. 894 55
A new cell line (LR10.6) with pre-B cell phenotype has been established from bone marrow cells obtained from a child with B lineage acute lymphoblastic leukemia in complete clinical remission. The line expresses nuclear TdT enzyme, cytoplasmic Ig lambda-chain and membrane mu-chain and other B but no T or myeloid markers. The cells also show activation antigens CD69 and CD71, adhesion molecules CD54, CD50 and CD56 and the tyrosine kinase receptor CD117. No expression of multidrug resistance phenotype MDR-1 is observed on these cells which nevertheless express the
transcriptional factor
p53 protein in a mutant form. Cytogenetic study shows a translocation t(5;12)(q31;p13) involving breakpoints which contain the growth factor interleukin 3 gene (5q31) and the recently identified TEL/ETV6 gene (12p13). Activation of the cells with phorbol-12 myristate 13-acetate (PMA) up-regulates the expression of the CD69 activation antigen and down-regulates the CD117 molecule. In addition, PMA fails to induce the CD20 B cell antigen.
Leukemia
1997 Jul
PMID:A new human cell line with pre-B cell phenotype and t(5;12). 920 88
1
2
3
4
Next >>