Gene/Protein Disease Symptom Drug Enzyme Compound
Pivot Concepts:   Target Concepts:
Query: UMLS:C0023418 (leukemia)
 93,477 document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)

The human T-cell leukemia virus (HTLV-I)-encoded Tax protein is a potent transcriptional activator that stimulates expression of the integrated provirus. Biochemical studies indicate that Tax, together with cellular transcription factors, interacts with viral cAMP-response element enhancer elements to recruit the pleiotropic coactivators CREB-binding protein and p300. Histone acetylation by these coactivators has been shown to play a major role in activating HTLV-I transcription from chromatin templates in vitro. However, the extent of histone modification and the precise identity of the cellular regulatory proteins bound at the HTLV-I promoter in vivo is not known. Chromatin immunoprecipitation analysis was used to investigate factor binding and histone modification at the integrated HTLV-I provirus in infected T-cells (SLB-1). These studies reveal the presence of Tax, a variety of ATF/CREB and AP-1 family members (CREB, CREB-2, ATF-1, ATF-2, c-Fos, and c-Jun), and both p300 and CREB-binding protein at the HTLV-I promoter. Consistent with the binding of these coactivators, we observed histone H3 and H4 acetylation at three regions within the proviral genome. Histone deacetylases were also present at the viral promoter and, following their inhibition, we observe an increase in histone H4 acetylation on the HTLV-I promoter and a concomitant increase in viral RNA. Together, these results suggest that a variety of transcriptional activators, coactivators, and histone deacetylases participate in the regulation of HTLV-I transcription in infected T-cells.
 ...
PMID:Transcription factor binding and histone modifications on the integrated proviral promoter in human T-cell leukemia virus-I-infected T-cells. 1238 57

Human T-cell leukemic virus type 1 (HTLV-1)-infected T cells express the fucosyltransferase (Fuc-T) VII gene involved in the biosynthesis of the leukocyte sialyl Lewis X, which may be related to tissue infiltration in patients with malignant adult T-cell leukemia. HTLV-1 induces Fuc-T VII transcription through the viral transactivator Tax, although the underlying molecular mechanism remains unknown. In the present study, we analyzed the role of the cis-activating element in Tax activation using reporter constructs bearing the 5'-regulatory region of Fuc-T VII in Jurkat T cells. A sequence (GGCTGTGGGGGCGTCATATTGCCCTGG) covering a half-palindromic cyclic adenosine monophosphate (cAMP)-responsive element (CRE) was found to be required for Tax activation of the Fuc-T VII promoter. We further demonstrated that transcription factors of the CRE-binding protein (CREB)/activating transcription factor (ATF) family bind to this CRE-like sequence and that Tax binds in association with CREB and the coactivator CREB-binding protein (CBP) in Jurkat T cells. This element, containing the G+C-rich flanking sequences, is homologous to the Tax-responsive viral CREs in the HTLV-1 long terminal repeat (LTR)-promoter. Furthermore, CREM alpha, an isoform of CREB deficient in the glutamine-rich domains, was found to activate the Fuc-T VII promoter in a phosphorylation-independent manner, similar to the viral CRE in HTLV-1 LTR but in contrast to the phosphorylation-dependent activation of the cellular CREs by Tax. These findings indicate that the Fuc-T VII promoter is transactivated by Tax in concert with CBP through a CRE-like sequence in a manner similar to that of viral CRE in HTLV-1 LTR.
 ...
PMID:Transactivation of the fucosyltransferase VII gene by human T-cell leukemia virus type 1 Tax through a variant cAMP-responsive element. 1250 41

Runx1/AML1 (also known as CBFA2 and PEBP23B) is a Runt family transcription factor critical for normal hematopoiesis. Runx1 forms a heterodimer with CBF3 and binds to the consensus PEBP2 sequence through the Runt domain. Runx1 enhances gene transcription by interacting with transcriptional coactivators such as p300 and CREB-binding protein. However, Runx1 can also suppress gene transcription by interacting with transcriptional corepressors, including mSin3A, TLE (mammalian homolog of Groucho), and histone deacetylases. Runx1 not only is critical for definitive hematopoiesis in the fetus but also is required for normal megakaryocytic maturation and T-lymphocyte and B-lymphocyte development in adult mice. Runx1 has been identified in leukemia-associated chromosomal translocations, including t(8;21) (Runx1-ETO/MTG8), t(16;21) (Runx1-MTG16), t(3;21) (Runx1-Evi1), t(12;21) (TEL-Runx1), and t(X;21) (Runx1-Fog2). The molecular mechanism of leukemogenesis by these fusion proteins is discussed. Various mutant mice expressing these fusion proteins have been created. However, expression of the fusion protein is not sufficient by itself to cause leukemia and likely requires additional events for leukemogenesis. Point mutations in a Runx1 allele cause haploinsufficiency and a biallelic null for Runx1, which are associated with familial platelet disorder with a propensity for acute myeloid leukemia (FPD/AML) and AML-M0, respectively. Thus, the correct protein structure and the precise dosage of Runx1 are essential for the maintenance of normal hematopoiesis.
 ...
PMID:Runx1/AML1 in normal and abnormal hematopoiesis. 1610 53

The human T-cell leukemia virus type 1 (HTLV-1) is integrated into the host cell DNA and assembled into nucleosomes. Within the repressive chromatin environment, the virally encoded Tax protein mediates the recruitment of the coactivators CREB-binding protein/p300 to the HTLV-1 promoter, located within the long terminal repeats (LTRs) of the provirus. These proteins carry acetyltransferase activity that is essential for strong transcriptional activation of the virus in the context of chromatin. Consistent with this, the amino-terminal tails of nucleosomal histones at the viral promoter are acetylated in Tax-expressing cells. We have developed a system in which we transfect Tax into cells carrying integrated copies of the HTLV-1 LTR driving the luciferase gene to analyze changes in "activating" histone modifications at the LTR. Unexpectedly, Tax transactivation led to an apparent reduction of these modifications at the HTLV-1 promoter and downstream region that correlates with a similar reduction in histone H3 and linker histone H1. Micrococcal nuclease protection analysis showed that less LTR-luciferase DNA is nucleosomal in Tax-expressing cells. Furthermore, nucleosome depletion correlated with RNA polymerase II recruitment and loss of SWI/SNF. The M47 Tax mutant, deficient in HTLV-1 transcriptional activation, was also defective for nucleosome depletion. Although this mutant formed complexes with CREB and p300 at the HTLV-1 promoter in vivo, it was unable to mediate RNA polymerase II recruitment or SWI/SNF displacement. These results support a model in which nucleosomes are depleted from the LTR and transcribed region during Tax-mediated transcriptional activation and correlate RNA polymerase II recruitment with nucleosome depletion.
 ...
PMID:Tax-dependent displacement of nucleosomes during transcriptional activation of human T-cell leukemia virus type 1. 1654 51

Potent activation of human T-cell leukemia virus type 1 (HTLV-1) gene expression is mediated by the virus-encoded transactivator protein Tax and three imperfect 21-bp repeats in the viral long terminal repeats. Each 21-bp repeat contains a cAMP-responsive-element core flanked by 5' G-rich and 3' C-rich sequences. Tax alone does not bind DNA. Rather, it interacts with basic domain-leucine zipper transcription factors CREB and ATF-1 to form ternary complexes with the 21-bp repeats. In the context of the ternary complexes, Tax contacts the G/C-rich sequences and recruits transcriptional coactivators CREB-binding protein (CBP)/p300 to effect potent transcriptional activation. Using an easily transduced and chromosomally integrated reporter system derived from a self-inactivating lentivirus vector, we showed in a BRG1- and BRM1-deficient adrenal carcinoma cell line, SW-13, that Tax- and 21-bp repeat-mediated transactivation does not require BRG1 or BRM1 and is not enhanced by BRG1. With a similar reporter system, we further demonstrated that Tax- and tumor necrosis factor alpha-induced NF-kappaB activation occurs readily in SW-13 cells in the absence of BRG1 and BRM1. These results suggest that the assembly of stable multiprotein complexes containing Tax, CREB/ATF-1, and CBP/p300 on the 21-bp repeats is the principal mechanism employed by Tax to preclude nucleosome formation at the HTLV-1 enhancer/promoter. This most likely bypasses the need for BRG1-containing chromatin-remodeling complexes. Likewise, recruitment of CBP/p300 by NF-kappaB may be sufficient to disrupt histone-DNA interaction for the initiation of transcription.
 ...
PMID:Versatile reporter systems show that transactivation by human T-cell leukemia virus type 1 Tax occurs independently of chromatin remodeling factor BRG1. 1684 Mar 26

In a previous study, we demonstrated immunoreactivity of a subset of neuronal intranuclear rodlets (INRs) in the human substantia nigra for promyelocytic leukaemia (PML) protein, the signature protein of PML bodies. In the present study, we extend these observations and describe the ultrastructural features, immunohistochemical staining characteristics, and topographical pattern of distribution of PML-immunoreactive intranuclear rodlets (PML-INRs). Consistent with a purported role for PML bodies in nuclear proteolysis and/or transcriptional regulation, PML-INRs are immunoreactive for components of the ubiquitin-proteasome system, the transcriptional regulator CREB-binding protein, acetylated histone H4, and the eukaryotic translation initiation factor eIF4E. Immunoelectron microscopy reveals that they all possess a filamentous core and, in some, this is surrounded by a granular shell. We further demonstrate that a proportion of INRs in extranigral sites also show partial immunoreactivity for PML. These observations indicate an intimate association between two neuronal nuclear bodies, PML bodies and INRs. Because both of these structures have been implicated in neurodegenerative disease, PML-INRs may provide a tool with which to study changes in nuclear substructure in disease.
 ...
PMID:Promyelocytic leukaemia-immunoreactive neuronal intranuclear rodlets in the human brain. 1723 8

Transcriptional activation of human T-cell leukemia virus type 1 (HTLV-1) is mediated by the viral oncoprotein Tax, which utilizes cellular transcriptional machinery to perform this function. The viral promoter carries three cyclic AMP-response elements (CREs), which are recognized by the cellular transcription factor cAMP-response element-binding protein (CREB). Tax binds to GC-rich sequences that immediately flank the CREs. The coactivator CREB-binding protein (CBP)/p300 binds to this promoter-bound ternary complex, which promotes the initiation of HTLV-1 transcription. Protein kinase A phosphorylation of CREB at serine 133 facilitates transcription from cellular CREs by recruiting CBP/p300 via its KIX domain. However, it remains controversial whether CREB phosphorylation plays a role in Tax transactivation. In this study, we biochemically characterized the quaternary complex formed by Tax, CREB, KIX, and the viral CRE by examining the individual molecular interactions that contribute to Tax stabilization in the complex. Our data show KIX, Ser(133)-phosphorylated CREB, and vCRE DNA are all required for stable Tax incorporation into the complex in vitro. Consonant with a fundamental role for CREB phosphorylation in Tax recruitment to the complex, we found that CREB is highly phosphorylated in a panel of HTLV-1-infected human T-cell lines. Significantly, we show that Tax is directly responsible for promoting elevated levels of CREB phosphorylation. Together, these data support a model in which Tax promotes CREB phosphorylation in vivo to ensure availability for Tax transactivation. Because pCREB has been implicated in leukemogenesis, enhancement of CREB phosphorylation by the virus may play a role in the etiology of adult T-cell leukemia.
 ...
PMID:Molecular characterization of the Tax-containing HTLV-1 enhancer complex reveals a prominent role for CREB phosphorylation in Tax transactivation. 1744 69

Coordinated regulation of PI3-kinase (PI3K) and the tumor suppressor phosphatase and tensin homologue deleted on chromosome 10 (PTEN) plays a pivotal role in various cell functions. PTEN is deficient in many cancer cells, including Jurkat human leukemia. Here, we demonstrate that the status of PTEN determines cellular susceptibility to oxidative stress through antioxidant-responsive element (ARE)-mediated transcription of detoxification genes. We found that ferritin H transcription was robustly induced in tert-butylhydroquinone (t-BHQ)-treated Jurkat cells via an ARE, and it was due to PTEN deficiency. Chromatin immunoprecipitation assays revealed that p300/CREB-binding protein (CBP) histone acetyltransferases and Nrf2 recruitment to the ARE and Bach1 release were blocked by the PI3K inhibitor LY294002, along with the partial inhibition of Nrf2 nuclear accumulation. Furthermore, acetylations of histone H3 Lys9 and Lys18, and deacetylation of Lys14 were associated with the PI3K-dependent ARE activation. Consistently, PTEN restoration in Jurkat cells inhibited t-BHQ-mediated expression of ferritin H and another ARE-regulated gene NAD(P)H:quinone oxidoreductase 1. Conversely, PTEN knockdown in K562 cells enhanced the response to t-BHQ. The PTEN status under t-BHQ treatment affected hydrogen peroxide-mediated caspase-3 cleavage. The PI3K-dependent ferritin H induction was observed by treatment with other ARE-activating agents ethoxyquin and hemin. Collectively, the status of PTEN determines chromatin modifications leading to ARE activation.
 ...
PMID:Role of the tumor suppressor PTEN in antioxidant responsive element-mediated transcription and associated histone modifications. 1915 75

The transcription factor encoded by the murine ecotropic integration site 1 gene (MEIS1) is a partner of HOX and PBX proteins. It has been implicated in embryonic patterning and leukemia, and causally linked to restless legs syndrome. The MEIS1A C terminus harbors a transcriptional activation domain that is stimulated by protein kinase A (PKA) in a manner dependent on the co-activator of cAMP response element-binding protein (CREB), CREB-binding protein (CBP). We explored the involvement of another mediator of PKA-inducible transcription, namely the CREB co-activators transducers of regulated CREB activity (TORCs). Overexpression of TORC1 or TORC2 bypassed PKA for activation by MEIS1A. Co-immunoprecipitation experiments demonstrated a physical interaction between MEIS1 and TORC2 that is dependent on the MEIS1A C terminus, whereas chromatin immunoprecipitation revealed PKA-inducible recruitment of MEIS1, PBX1, and TORC2 on the MEIS1 target genes Hoxb2 and Meis1. The MEIS1 interaction domain on TORC1 was mapped to the N-terminal coiled-coil region, and TORC1 mutants lacking this domain attenuated the response to PKA on a natural MEIS1A target enhancer. Thus, TORCs physically cooperate with MEIS1 to achieve PKA-inducible transactivation through the MEIS1A C terminus, suggesting a concerted action in developmental and oncogenic processes.
 ...
PMID:Transcriptional activation by MEIS1A in response to protein kinase A signaling requires the transducers of regulated CREB family of CREB co-activators. 1947 90

Latent infection of human T-cell leukemia virus type 1 (HTLV-1) is considered to be preferentially associated with CCR4(+) CD4(+) T cells. Here we report that c-Maf, one of the critical transcription factors for Th2 differentiation, suppresses the transcriptional activity of HTLV-1 Tax by competing for CREB-binding protein. Notably, c-maf expression is selectively induced in a fraction of CCR4(+) CD4(+) T cells upon activation. Furthermore, c-Maf significantly decreases Tax-induced HTLV-1 envelope gp46 gene expression from an infectious HTLV-1 molecular clone and tax expression in a cell-free HTLV-1 infection system. Collectively, c-Maf may play a role in latent infection of HTLV-1 in CCR4(+) CD4(+) T cells by negatively regulating Tax activity.
 ...
PMID:c-Maf suppresses human T-cell leukemia virus type 1 Tax by competing for CREB-binding protein. 2124 76


<< Previous 1 2 3 4 Next >>