Gene/Protein Disease Symptom Drug Enzyme Compound
Pivot Concepts:   Target Concepts:
Query: UMLS:C0023418 (leukemia)
93,477 document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)

To identify the regions that are important in human T-cell leukemia virus type 1 (HTLV-1) envelope function, we synthesized 23 kinds of peptides covering the envelope proteins and examined the inhibitory effect of each peptide on syncytium formation induced by HTLV-1-bearing cells. Of the 23 synthetic peptides, 2, corresponding to amino acids 197 to 216 on gp46 and 400 to 429 on gp21, inhibited syncytium formation induced by HTLV-1-bearing cells but did not affect syncytium formation induced by human immunodeficiency virus type 1-producing cells. The peptide concentrations giving 50% inhibition of syncytium formation for gp46 197 to 216 and gp21 400 to 429 were 14.9 and 6.0 microM, respectively. A syncytium formation assay with overlapping synthetic peptides containing amino acids 175 to 236 and 391 to 448 of the envelope proteins showed that syncytium formation was inhibited by peptides that contained the amino acid sequences 197 to 205 (Asp-His-Ile-Leu-Glu-Pro-Ser-Ile-Pro) and 397 to 406 (Gln-Glu-Gln-Cys-Arg-Phe- Pro-Asn-Ile-Thr). These observations suggest that the two regions corresponding to amino acids 197 to 216 and 400 to 429 are involved] in HTLV-1 envelope function.
...
PMID:Identification and mapping of functional domains on human T-cell lymphotropic virus type 1 envelope proteins by using synthetic peptides. 862 75

The Tpl-2 protein serine/threonine kinase was originally identified, in a C-terminally deleted form, as the product of an oncogene associated with the progression of Moloney murine leukemia virus-induced T cell lymphomas in rats. The kinase domain of Tpl-2 is homologous to the Saccharomyces cerevisiae gene product, STE11, which encodes a MAP kinase kinase kinase. This suggested that Tpl-2 might have a similar activity. Consistent with this hypothesis, immunoprecipitated Tpl-2 and Tpl-2deltaC (a C-terminally truncated mutant) phosphorylated and activated recombinant fusion proteins of the mammalian MAP kinase kinases, MEK-1 and SEK-1, in vitro. Furthermore, transfection of Tpl-2 into COS-1 cells or Jurkat T cells. markedly activated the MAP kinases, ERK-1 and SAP kinase (JNK), which are substrates for MEK-1 and SEK-1, respectively. Tpl-2, therefore, is a MAP kinase kinase kinase which can activate two MAP kinase pathways. After Raf and Mos, Tpl-2 is the third serine/threonine oncoprotein kinase that has been shown to function as a direct activator of MEK-1.
...
PMID:Activation of MEK-1 and SEK-1 by Tpl-2 proto-oncoprotein, a novel MAP kinase kinase kinase. 863 3

Deletion mutants of the intracytoplasmic domain of the granulocyte colony stimulating factor receptor (G-CSFR) have shown that it contains a membrane-proximal region which must be conserved to allow the receptor to transduce a mitotic signal, and a C-terminal region necessary for transduction of cell differentiation. Changes in the intracytoplasmic domain may result in the uncoupling of these two processes, as in acute leukaemia, and such alterations could occur either as isoforms or mutations. We have studied the transmembrane domain and intracytoplasmic tail of the G-CSFR in RNA from blood or bone marrow of 11 haematologically normal controls and 40 patients with acute myeloid leukaemia (AML). Two novel transcripts of the receptor were identified, both were minor components and are unlikely to be of major physiological significance. We could find no evidence for altered levels of expression of these transcripts in the AML patients. In addition, only one point mutation was detected in the 40 patients screened by RT-PCR-SSCP, a C-->A substitution at nucleotide 2088 which changes a threonine to asparagine in the transmembrane domain and is probably a polymorphism. These results suggest that abnormalities in the G-CSFR are uncommon in AML.
...
PMID:Analysis of granulocyte colony stimulating factor receptor isoforms, polymorphisms and mutations in normal haemopoietic cells and acute myeloid leukaemia blasts. 865 69

DNA fragmentation and internucleosomal cleavage were rapidly initiated after lysosomal photodamage to murine leukemia cells, with apoptotic chromatin and DNA 'ladders' detected within 30 min after irradiation. Apoptosis was inhibited by concurrent exposure of cells to a 10 nM concentration of the serine-threonine phosphatase inhibitor calyculin A and promoted by a serine/threonine kinase inhibitor. These results indicate that a late stage in apoptosis requires serine/threonine dephosphorylation.
...
PMID:The phosphatase inhibitor calyculin antagonizes the rapid initiation of apoptosis by photodynamic therapy. 866 Mar 46

To study the involvement of serine/threonine phosphatase in the signal transduction of mast cells, we examined the effects of okadaic acid (OA), an inhibitor of type-1 and -2A phosphatase on histamine release, cell morphology, calcium influx and protein phosphorylation of rat basophilic leukemia (RBL-2H3) cells, human basophils and rat peritoneal mast cells. OA inhibited IgE-mediated histamine release from RBL-2H3 cells and human basophils dose-dependently. There was a remarkable enhancement of IgE-mediated histamine release when rat peritoneal mast cells were suboptimally challenged. OA induced a marked change of cell features, detached RBL-2H3 cells from plastic well and kept the 18- and 68-kD proteins phosphorylated. These findings show that phosphatase may play a role in the modulation of secretion in mast cells.
...
PMID:The effect of okadaic acid on histamine release, cell morphology and phosphorylation in rat basophilic leukemia (RBL-2H3) cells, human basophils and rat peritoneal mast cells. 876 1

To study acute myelogenous leukemia 1 (AML1) transcription factor, ETO protein, and t(8;21) AML chimeric AML1/ ETO protein in normal hematopoiesis and in leukemia, we raised rabbit antisera to a bacterially expressed polypeptide containing amino acid residues 1 to 220 of ETO and to synthetic peptides extending from residues 528 to 548 of ETO and 32 to 50 of AML1. The latter was selected to have little chance of cross-reactivity with other members of the PEBP2 alpha family. With affinity-purified reagents, we observed immunofluorescent staining for both AML1 and ETO in the nucleus of HEL, K562, and Kasumi-1 leukemic cell lines, the last from a t(8;21) AML. Biochemical analysis confirmed specificity of the antibodies and the nuclear localization of the antigens, the latter being exclusive for AML1 and primary for ETO. Immunoprecipitations of metabolically labeled 32P-proteins from Kasumi-1 cells show that AML1 and ETO are phosphorylated on serine and threonine. Investigations with normal bone marrow reveal AML1 and ETO are coexpressed in megakaryocytes and that each is expressed in a portion of the approximately 10-microns-diameter cells residing there. Using a CD34+ enriched population mobilized to peripheral blood, we found AML1 and, unexpectedly, ETO present in these cells. Because of this, we conclude that the expression of ETO in hematopoietic cells is not by itself leukemogenic. Also, because ETO would not be exclusively expressed as part of chimeric AML1/ETO in leukemic patients, its presence cannot be used to monitor t(8;21) AML residual disease.
...
PMID:ETO and AML1 phosphoproteins are expressed in CD34+ hematopoietic progenitors: implications for t(8;21) leukemogenesis and monitoring residual disease. 878 39

The c-myb protooncogene encodes a highly conserved 75-89-kDa transcription factor that contains three functional domains, an amino-terminal DNA binding domain (DBD), a central acidic transactivation domain, and a carboxyl-terminal negative regulatory domain (NRD). Two acute transforming retroviruses, avian myeloblastosis virus and the E26 leukemia virus, transduced portions of c-myb and encode Myb proteins that are truncated in both the DBD and the NRD. Several conserved potential sites for phosphorylation by proline-directed serine/threonine protein kinases reside in or near the NRD, suggesting that phosphorylation might play a role in regulating c-Myb. We have previously demonstrated that serine 528, located in the NRD, is a target for p42(mapk) in vitro. Serine 528 is phosphorylated in vivo in several cell lines, and substitution of serine 528 to alanine (S528A) resulted in an increased ability of Myb to transactivate a synthetic promoter containing five copies of the mim-1A Myb-responsive element and a minimal herpes tk promoter. We have tested the ability of S528A Myb to transactivate a series of cellular target promoters and report that the serine to alanine substitution increased the ability of Myb to activate transcription from the CD34 promoter but not the c-myc or mim-1 promoters. This suggests that phosphorylation of serine 528 may differentially regulate c-Myb activity at different promoters. The DNA binding and multimerization activities of c-Myb appear to be unaffected by the S528A substitution, suggesting that phosphorylation of serine 528 may mediate its effect on the transcription transactivating activity of c-Myb by regulating interactions with other proteins.
...
PMID:Differential regulation of c-Myb-induced transcription activation by a phosphorylation site in the negative regulatory domain. 879 43

Myelopeptide-2 (MP-2) Leu-Val-Val-Tyr-Pro-Trp originally isolated from the supernatant of porcine bone marrow cell culture was examined for its capacity to restore the mitogen responsiveness of human T lymphocytes inhibited by conditioned media from HL-60 leukemia cells (HL-60 CM). MP-2 added to phytohemagglutinin (PHA)-stimulated T lymphocytes together with HL-60 CM abolished the suppression of T-lymphocyte proliferative response in a dose-dependent manner. Another bone marrow hexapeptide Phe-Leu-Gly-Phe-Pro-Thr, MP-1, did not display this action in that experimental system. MP-2 was also effective being added after T-lymphocyte exposure to HL-60 CM which suggests its recovery but not protective effect on T-lymphocytes treated with tumor cell products. Flow cytometry analysis revealed HL-60 CM influence on the expression of CD3 and CD4 T-cell surface antigens. It decreased the content of CD3- and CD4-positive cells and induced the appearance of T lymphocytes with reduced density of CD3 and CD4 antigens. MP-2 was able to restore the T-cell phenotype altered by HL-60 CM. MP-2 seems to be promising in anti-tumor therapy.
...
PMID:The bone marrow peptide (myelopeptide-2) abolishes induced by human leukemia HL-60 cell suppression of T lymphocytes. 880 11

Human cDNA and genomic DNA encoding cyclin G were cloned and analyzed. The amino acid sequence of cyclin G is well conserved among mammals. Human cyclin G (295 amino acids) has one extra Thr at residue 6 compared with rat and mouse cyclin G (294 amino acids). The genomic DNA for human cyclin G consists of six exons, and in the first intron, one distinct putative binding site for the p53 tumor suppressor gene product (GCACAAGCCCAGGCTAGTCC) was detected. We performed chromosome mapping utilizing the fluorescence in situ hybridization (FISH) technique using both cDNA and genomic DNA for cyclin G. FISH localizes human cyclin G to the 5q32-q34 region. In the vicinity of the chromosomal location of human cyclin G, four cases of chromosomal translocations in human hematopoietic tumors have been reported, such as a subgroup of chronic myelomonocytic leukemia, non-Hodgkin lymphoma, and acute lymphocytic leukemia. It is therefore important to examine whether chromosomal translocations around this region cause aberrant cyclin G expression in a manner that is causally related to leukemia.
...
PMID:Structure and chromosomal assignment of the human cyclin G gene. 895 86

Halicylindramides D (1) and E (2) have been isolated from the marine sponge Halichondria cylindrata. Halicylindramide D is a tridecapeptide with the N-terminus blocked by a formyl group and the C-terminus lactonized with a threonine residue, while halicylindramide E is a truncated linear peptide with a C-terminal amide. Their structures, including absolute stereochemistry, were determined by a combination of spectral and chemical methods. Halicylindramide D was antifungal against Mortierella ramanniana and cytotoxic against P-388 murine leukemia cells.
...
PMID:Halicylindramides D and E, antifungal peptides from the marine sponge Halichondria cylindrata. 899 50


<< Previous 1 2 3 4 5 6 7 8 9 10 Next >>