Gene/Protein
Disease
Symptom
Drug
Enzyme
Compound
Pivot Concepts:
Gene/Protein
Disease
Symptom
Drug
Enzyme
Compound
Target Concepts:
Gene/Protein
Disease
Symptom
Drug
Enzyme
Compound
Query: UMLS:C0021051 (
immunodeficiency
)
71,517
document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)
Eleven medications used in the treatment of the human
immunodeficiency
virus or subsequent opportunistic infections were tested to determine their toxicity to the growth of the CEM line of transformed CD4+ T-cells. A selectivity ratio (IC50/EC50) for each agent against its target pathogen was calculated as an in vitro indication of the therapeutic value of that agent. Among the anti-HIV agents tested in this study, 2',3'-dideoxyinosine (ddI) had the highest in vitro selectivity ratio, 2.5 times higher than that of 3'-azido-3'-deoxythymidine (AZT).
Dapsone
had the highest selectivity ratio of the four agents used in the treatment of Pneumocystis carinii pneumonia that were tested. Ketoconazole had a very low selectivity ratio for Candida spp. due to its very high toxicity to CD4+T-cells.
...
PMID:The selective toxicity of medications used in the treatment of AIDS on the CEM human leukemic CD4+ T-cell line. 168 33
Dapsone
, administered at various doses and schedules, has been proven to be a safe and effective alternative to trimethoprim-sulfamethoxazole for prevention of Pneumocystis carinii pneumonia (PCP) in adults with human
immunodeficiency
virus (HIV) infection.
Dapsone
is also recommended by the Centers for Disease Control for PCP prophylaxis in HIV-infected children. However, the suggested dosage regimen is based upon clinical experience with children with leprosy and dermatitis herpetiformis rather than pharmacokinetic and pharmacodynamic data obtained from the target patient population. In order to determine a rational dosage regimen that could be tested in clinical studies aimed at the evaluation of dapsone for the prevention of PCP in HIV-infected children, we studied the pharmacokinetics of dapsone following a 2-mg/kg of body weight oral dose in twelve HIV-positive children aged 9 months to 9 years. Plasma was collected at the following times after dapsone administration: 0, 2, 4, 6, 12, 24, 48, 72, and 96 h. The levels of dapsone in plasma were determined by high-performance liquid chromatography. Data were analyzed by noncompartmental methods. Expressed as means +/- standard deviations (ranges), the pharmacokinetic parameters were as follows: peak concentration in plasma, 1.12 +/- 0.48 (0.44 to 1.81) mg/liter; time to peak concentration in plasma, 3.8 +/- 1.3 (2 to 6) h; half-life at elimination phase, 24.2 +/- 7.1 (14.4 to 35.0) h; clearance from plasma divided by bioavailability (CL/F), 1.15 +/- 0.67 (0.37 to 2.63) ml/min/kg; and volume of distribution divided by bioavailability (V/F), 2.25 +/- 1.20 (1.00 to 4.57) liters/kg. Oral CL correlated negatively with age (r = 0.614 and P = 0.034), as did V (r = 0.631 and P = 0.028). As a consequence of the high interindividual variability in growth retardation, pharmacokinetic parameters correlated with measures of body development better than they did with age (e.g., for CL/F to height, r = 0.765 and P = 0.004, and for V/F to height, r = 0.748 and P = 0.005). Since oral CL from plasma and V were positively and highly correlated (r = 0.898 and P = 0.0001), a lower absolute F may be the cause, in part, of higher values for CL/F and V/F in smaller children. The results of this study warrant the testing of a 2-mg/kg dose of dapsone administered twice or thrice weekly to HIV-infected children. The monitoring of drug levels in plasma and dosage adjustment may be necessary for smaller children.
...
PMID:Pharmacokinetics of dapsone in human immunodeficiency virus-infected children. 762 96
Inhibitory effects on human
immunodeficiency
virus (HIV) reproduction on lymphoid cell line MT-4 were characterized for antisense and sense oligodeoxynucleotides. It was established that antisense oligonucleotide pCGTAGTTCGTCGAGGTCCGT (MP-20) (ID50 = 0.1 microM) is a more effective HIV inhibitor than the previously described pTGGCGTACTCACCAGTCGCCGC (
DSS
-22) (ID50 = 4.7 microM) and pTTTTTTTTTTTTTTTT (PA-16) (ID50 = 8.0 microM). A sense oligonucleotide pGCATCAAGCAGCTCCAGGCA (PM-20) (ID50 = 0.5 microM) complementary to the region of the start of translation of the open reading frame on the (+)-chain virus DNA was also investigated. Specificity of the anti-HIV-I action of oligonucleotides was confirmed by experiments with HIV-II.
...
PMID:[Inhibition of reproduction of the human immunodeficiency virus by sense and antisense oligodeoxynucleotides]. 824 27
Twenty-one human
immunodeficiency
virus (HIV)-free and six HIV-infected adults with autoimmune thrombocytopenic purpura (AITP) were treated with dapsone (100 mg/day). A response was observed in 13 patients (median platelet count before 25 x 10(9)/L, range 3-49; after 109 x 10(9)/L, range 69-241). Thrombocytopenia recurred in four of the responders in whom dapsone was discontinued. No response was observed in 12 patients.
Dapsone
had to be withdrawn after two weeks of treatment in the remaining two patients and after six to eight weeks in three other patients due to intolerance. No serious hematological complications were observed. These results confirm that dapsone is a safe, inexpensive, and effective treatment of AITP.
...
PMID:Dapsone for autoimmune thrombocytopenic purpura. 819 58
Zidovudine is widely prescribed for the treatment of human
immunodeficiency
virus (HIV) infection. Trimethoprim and dapsone are commonly used in the management of Pneumocystis carinii pneumonia in HIV-infected patients. To examine the pharmacokinetic interactions among these drugs, eight HIV-infected patients (26 to 43 years old) with a mean CD4 count of 524.4 +/- 405.7 cells per mm3 received zidovudine (200 mg), trimethoprim (200 mg), and dapsone (100 mg) as single agents and in two- and three-drug combinations. Blood and urine samples were collected at a specified time and analyzed for zidovudine, zidovudine-glucuronide, trimethoprim, dapsone, and monoacetyl-dapsone concentrations under single-dose and steady-state conditions. Zidovudine did not influence the pharmacokinetic disposition of dapsone or trimethoprim.
Dapsone
had no effect on the pharmacokinetic disposition of zidovudine. Trimethoprim significantly decreased the renal clearance of zidovudine by 58% (5.0 +/- 1.8 versus 2.1 +/- 0.5 ml/min/kg of body weight [P < 0.05]). There was a concurrent 54% decrease in the mean urinary recovery of zidovudine (11.7 +/- 3.5 versus 5.4 +/- 3.0 [P < 0.05]), and the metabolic ratio was decreased by 78% (0.32 +/- 0.4 versus 0.07 +/- 0.05 [P < 0.05]). The mean area under the concentration-time curve from 0 to 6 h of the zidovudine-glucuronide/ zidovudine ratio was unchanged. We conclude that zidovudine, trimethoprim, and dapsone can be coadministered to patients with AIDS without significant pharmacokinetic interaction. However, in AIDS patients with liver impairment and impaired glucuronidation, doses of zidovudine may need to be decreased.
...
PMID:Zidovudine, trimethoprim, and dapsone pharmacokinetic interactions in patients with human immunodeficiency virus infection. 872 72
A 78-year-old woman with a history of symmetrical erythematous plaques on the arms, and a monoclonal gammopathy, developed a strange striped reticulate papular dermatosis with central atrophy. Histological examination was compatible with a very late stage of erythema elevatum diutinum (EED), showing a fibrohistiocytic proliferation with areas of granulation tissue. This fibrosis may result from the chronic dermal injury of leucocytoclastic vasculitis and is sometimes the predominant histology of EED. Investigations for underlying haematological anomalies, such as paraproteinaemia and infection with human
immunodeficiency
virus, must be performed.
Dapsone
is ineffective once the fibrous nodules have appeared.
...
PMID:Unusual erythema elevatum diutinum with fibrohistiocytic proliferation. 876 40
Here we present the case of a patient affected with a unique association of Sweet's syndrome, idiopathic myelofibrosis, spindle-cell thymoma, myasthenia gravis and Good's syndrome (a rare form of thymoma-related, combined
immunodeficiency
presenting with recurrent respiratory infections). Conventional therapies (corticosteroids, colchicine,
DDS
, clofazimine) were ineffective or were contraindicated. Treatment with etretinate (50 mg/day) proved effective on skin lesions. Moreover, the patient's general condition unexpectedly improved, with long-lasting (11 months) suppression of respiratory infections and a slight but consistent improvement of hematological parameters such as Hct, MCV, Hb level, RBC, WBC and lymphocyte absolute counts.
...
PMID:Sweet's syndrome in a patient with idiopathic myelofibrosis and thymoma-myasthenia gravis-immunodeficiency complex: efficacy of treatment with etretinate. 890 Aug 54
We studied the penetration of dapsone into the epithelial lining fluid (ELF) of sixteen human
immunodeficiency
virus type 1-infected patients who had received the drug at a dose of 100 mg twice weekly as primary prophylaxis for Pneumocystis carinii pneumonia. Bronchoscopy, bronchoalveolar lavage (BAL), and venipuncture were performed for each patient at a specific time after administration of the last dose of dapsone.
Dapsone
concentrations in plasma and BAL were determined by high-performance liquid chromatography. The apparent volume of ELF recovered by BAL was determined by using urea as an endogenous marker. The mean concentrations of dapsone in ELF at 2 h (five patients), 4 h (three patients), 12 h (two patients), 24 h (three patients), and 48 h (three patients) were 0.95, 0.70, 1.55, 0.23, and 0.45 mg/liter, respectively, while concentrations in plasma were 1.23, 0.79, 1.31, 0.83, and 0.18 mg/liter, respectively.
Dapsone
concentrations in ELF were 76, 79, 115, 65, and 291% of those observed in plasma at the same times, respectively. These data show that dapsone is well distributed into ELF and that a twice-weekly 100-mg prophylactic regimen results in sustained concentrations in this compartment.
...
PMID:Penetration of dapsone into pulmonary lining fluid of human immunodeficiency virus type 1-infected patients. 914 73
It has been proposed that dapsone in combination with pyrimethamine could be used for prophylaxis of both Pneumocystis carinii pneumonia and encephalitis due to Toxoplasma gondii. Ten patients with AIDS undergoing lumbar puncture for diagnostic purposes were studied in order to assess the penetration of dapsone into CSF. Blood and CSF samples were obtained between 3 and 72 h following administration. Six patients had received oral dapsone for at least 1 month at the dosage regimen of 100 mg twice of three times weekly and four patients had received a single oral 100 mg dose.
Dapsone
concentration in CSF ranged from 0.013 to 0.296 mg/L while concentrations in plasma ranged from 0.018 to 1.231 mg/L. The CSF:plasma concentration ratio ranged from 0.21 to 2.01. The MIC of dapsone in combination with pyrimethamine against T. gondii is unknown, and further data are required to confirm whether the CSF concentrations of dapsone found in our study are sufficient to inhibit T. gondii growth in patients infected with human
immunodeficiency
virus (HIV). The high interpatient variability of dapsone CSF concentrations warrants further studies in selected categories of patients with HIV infection.
...
PMID:Penetration of dapsone into cerebrospinal fluid of patients with AIDS. 924 13
Hypersensitivity (HS) reactions to sulfonamides and sulfones continue to limit their use in human
immunodeficiency
virus (HIV)-infected individuals. In vitro cytotoxicity of hydroxylamine metabolites toward peripheral blood mononuclear cells (PBMCs) has been proposed as a marker for these HS reactions. To test the validity of this in vitro system, we determined the selective susceptibility of PBMCs from HIV-infected patients to the cytotoxic effects of hydroxylamine metabolites of sulfamethoxazole (SMX) and dapsone (
DDS
). Concentration-cytotoxic response data were collected using PBMCs from 12 sulfa-HS (10 SMX-HS and 2 SMX/
DDS
-HS) and 10 sulfa-tolerant HIV-infected individuals. Although sulfamethoxazole hydroxylamine (SMX-NOH) and dapsone hydroxylamine (
DDS
-NOH) both caused concentration-dependent increases in cell death,
DDS
-NOH was significantly more potent in each subject (P <.0001). A comparison of a variety of mean data for sulfa-HS and -tolerant patient populations failed to demonstrate the increased susceptibility of PBMCs from HS patients, noted by others, to either SMX-NOH or
DDS
-NOH. Moreover, any trend toward an increased susceptibility of PBMCs from HS patients was eliminated when adjusted for control cell death. PBMCs from sulfa-HS patients showed significantly greater susceptibility to the stress of short term in vitro incubation (P <. 02). Mean (S.D.) vehicle control cell death values were 24.1% (7.6%) for HS patients and 17.1% (4.4%) for tolerant patients. No significant correlation was observed between hydroxylamine-induced or control cell death and any of the recorded clinical parameters. Although several potential reasons are proposed to explain the disparity with past investigations, the data suggest that in vitro cytotoxicity is not a valid marker for HS reactions in HIV-infected individuals using currently accepted experimental procedures.
...
PMID:Is hydroxylamine-induced cytotoxicity a valid marker for hypersensitivity reactions to sulfamethoxazole in human immunodeficiency virus-infected individuals? 1056 61
1
2
Next >>