Gene/Protein
Disease
Symptom
Drug
Enzyme
Compound
Pivot Concepts:
Gene/Protein
Disease
Symptom
Drug
Enzyme
Compound
Target Concepts:
Gene/Protein
Disease
Symptom
Drug
Enzyme
Compound
Query: UMLS:C0019829 (
Hodgkin's disease
)
30,247
document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)
DNA from 161 patients with various forms of hematologic malignancies were investigated for mutations in exons 1 and 2 of the N-RAS, K-RAS and Ha-RAS gene by direct sequencing of DNA amplified in vitro by the polymerase chain reaction. Mutations involving either codons 11, 12, or 13 of the N-RAS gene were identified in 18 of the 161 patients. The relative frequencies of N-RAS gene mutations in these hematologic disorders was as follows: acute myelogenous leukemia (AML), 15%; acute lymphoblastic leukemia (ALL), 14%; myelodysplastic syndromes, 24%; and myeloid and lymphoid blast crisis of chronic myelogenous leukemia (CML), 3%. No correlation was observed between the presence of mutations and cytologic features or immunophenotype of these malignancies. Mutations involving codons 12 or 13 were equally prevalent, with a glycine to aspartic acid substitution being the most frequently encountered change. A single T-ALL case had a codon 11 mutation resulting in substitution of alanine with
threonine
. We failed to find mutations in exons 1 and 2 of the K-RAS or Ha-RAS genes in any case except a single AML with a mutation in codon 61 of the K-RAS gene. Also, no mutations were identified in chronic phase of CML, chronic lymphocytic leukemia. Ph1 positive ALL, non-Hodgkin's lymphoma,
Hodgkin's disease
, or multiple myeloma. These results indicate that RAS mutations, especially those involving exon 1 of the N-RAS gene, are frequent only in a subset of hematologic malignancies.
...
PMID:The pattern of mutational involvement of RAS genes in human hematologic malignancies determined by DNA amplification and direct sequencing. 218 88
LMP-1 is the only Epstein-Barr virus-encoded latent protein known to have the properties of a transforming oncogene in rodent fibroblasts and the only latent protein, besides EBNA-1, detected in nasopharyngeal carcinoma and
Hodgkin's lymphoma
biopsies. LMP-1 is characterized by serine/
threonine
phosphorylation and rapid turnover (half-life, 2 to 3 h) due to specific proteolytic cleavage, which causes release of a phosphorylated C-terminal fragment (p25) into the cytoplasm. We used biochemical, functional, and mutational analyses to identify sites of phosphorylation. All of the phosphorylation sites detected lie in the C-terminal domain. In particular, we identified S-313 and T-324 as functionally important sites. Prevention of phosphorylation at S-313, by altering it to a glycine, prevented detectable phosphorylation of both LMP-1 and p25, indicating that it is a major site on both forms of the molecule. However, lack of detectable phosphorylation had no effect on p25 cleavage or on the ability of LMP-1 to transform Rat-1 fibroblasts. Alteration of S-313 to an aspartate resulted in a form of LMP-1 that was toxic to Rat-1 cells. Alteration of T-324 to a glycine residue had no detectable effect on the ability of LMP-1 to become serine phosphorylated or transform Rat-1 cells. Alteration of T-324 to a glutamate, however, inhibited all detectable phosphorylation and resulted in a form of LMP-1 that was unable to transform Rat-1 fibroblasts. These results are discussed in the context of a model in which LMP-1 function is modulated by phosphorylation and dephosphorylation at S-313 and T-324.
...
PMID:Biochemical, genetic, and functional analyses of the phosphorylation sites on the Epstein-Barr virus-encoded oncogenic latent membrane protein LMP-1. 838 69
p21 is induced by and mediates the effects of p53 in response to DNA damage arresting the cell in G1 or G2, by inhibiting multiple cyclin-cyclin-dependent kinases (CDK) or binding to proliferating-cell nuclear antigen (PCNA), respectively. To determine whether p21 mutants occur in tumors we examined DNA from 188 primary non-
Hodgkin
's B-cell lymphoma (NHL) tumors and 84 chronic myelogenous leukemia samples for mutational changes in the coding region of p21 by single-strand conformation polymorphism (SSCP) analysis and direct sequencing of polymerase chain reaction (PCR)-amplified DNA. We did not find mutations in the coding region in these two tumor types. We identified a polymorphic nucleotide change in codon 31 in which a transversion from C to A substituted amino acid arginine for serine. Three of 188 NHL tumors were homozygous for this change, but they were not identified in 84 CMLs or in 97 normal controls. On the other hand, in one CML case a transition from G to A in codon 64 substituted amino acid
threonine
for alanine. These data do not indicate that derangements in the coding region of p21 contribute to the initiation and/or progression of these tumors.
...
PMID:Absence of somatic changes in p21 gene in non-Hodgkin's lymphoma and chronic myelogenous leukemia. 865 61
Human cDNA and genomic DNA encoding cyclin G were cloned and analyzed. The amino acid sequence of cyclin G is well conserved among mammals. Human cyclin G (295 amino acids) has one extra
Thr
at residue 6 compared with rat and mouse cyclin G (294 amino acids). The genomic DNA for human cyclin G consists of six exons, and in the first intron, one distinct putative binding site for the p53 tumor suppressor gene product (GCACAAGCCCAGGCTAGTCC) was detected. We performed chromosome mapping utilizing the fluorescence in situ hybridization (FISH) technique using both cDNA and genomic DNA for cyclin G. FISH localizes human cyclin G to the 5q32-q34 region. In the vicinity of the chromosomal location of human cyclin G, four cases of chromosomal translocations in human hematopoietic tumors have been reported, such as a subgroup of chronic myelomonocytic leukemia, non-
Hodgkin lymphoma
, and acute lymphocytic leukemia. It is therefore important to examine whether chromosomal translocations around this region cause aberrant cyclin G expression in a manner that is causally related to leukemia.
...
PMID:Structure and chromosomal assignment of the human cyclin G gene. 895 86
Ki-1/57, the 57-kDa human protein antigen recognized by the CD30 antibody Ki-1, is a cytoplasmic and nuclear protein that is phosphorylated on serine and
threonine
residues. When isolated from the
Hodgkin's lymphoma
analogous cell line L540 Ki-1/57 co-immunoprecipitated with a
Thr
/Ser protein kinase activity. It has been also found to interact with hyaluronic acid and has therefore been termed intracellular IHABP4 (hyaluronan-binding protein 4). Recent studies demonstrated, however, that Ki-1/57 engages in specific interaction with the chromo-helicase-DNA-binding domain protein 3, a nuclear protein involved in chromatin remodeling and transcription regulation. We used the yeast two-hybrid system to find proteins interacting with Ki-1/57 and identified the adaptor protein RACK1 (receptor of activated kinase 1). Next, we confirmed this interaction in vitro and in vivo, performed detailed mapping studies of the interaction sites of Ki-1/57 and RACK-1, and demonstrated that Ki-1/57 also co-precipitates with protein kinase C (PKC) when isolated from phorbol 12-myristate 13-acetate (PMA)-activated L540 tumor cells and is a substrate for PKC phosphorylation in vitro and in vivo. Interestingly, the interaction of Ki-1/57 with RACK1 is abolished upon activation of L540 cells with PMA, which results in the phosphorylation of Ki-1/57 and its exit from the nucleus. Taken together, our data suggest that Ki-1/57 forms a stable complex with RACK-1 in unstimulated cells and upon PMA stimulation gets phosphorylated on
threonine
residues located at its extreme C terminus. These events associate Ki-1/57 with the RACK1/PKC pathway and may be important for the regulation of its cellular functions.
...
PMID:Ki-1/57 interacts with RACK1 and is a substrate for the phosphorylation by phorbol 12-myristate 13-acetate-activated protein kinase C. 1469 38
Polo-like kinases (PLKs) are protein serine/
threonine
kinases that play important roles in cell division. Expression of PLK1 might, moreover, play a role in the pathogenesis of human neoplasms. The expression of PLK1 mRNA is closely correlated with survival in patients with malignant tumors. We investigated the expression of PLK1 in non-
Hodgkin
's lymphomas (NHLs) and analyzed the relationships between expression of PLK1, histological grade, and prognosis. We analyzed various types of NHLs from 118 patients using monoclonal antibodies against PLK1 and Ki-67. The levels of expression of PLK1 and Ki-67 were significantly lower in low-grade NHLs than in high-grade and intermediate-grade NHLs (P < 0.001). Moreover, when patients were grouped in terms of 5-year overall survival ( > 70%, group A; 50 - 70%, group B; 30 - 49%, group C; and < 30%, group D), levels of expression of PLK1 and Ki-67 were found to be significantly higher in group D than in group A and they were also significantly higher in group C than in group A (P < 0.001). Conversely, the level of expression, of Ki-67 was significantly lower in group D than in group C (P < 0.05). The labeling indices specific for PLK1 were generally higher than those specific for Ki-67. Once we divided all patients into two groups in terms of the expression levels, high-level expression group of PLK1 (PLK1 index of 70%) and Ki-67 (Ki-67 indices of 60%) and low-level expression, one of these markers (PLK1 index of >/= 70%, Ki-67 indices of >/= 60%) had a similar prognosis, an observation that can be explained by the fact that rapidly proliferating group is more drug-sensitive than the other. Our study demonstrates that expression of PLK1 might reflect the malignant potential of NHLs and that PLK1 might be more useful than Ki-67 for the detection of proliferative cells.
...
PMID:Expression of Polo-Like Kinase (PLK1) in non-Hodgkin's lymphomas. 1562 5
Lipid kinase PIK3CA mutations have been described in several cancers. They clustered in two 'hot spots' located in helical (exon 9) and kinase (exon 20) domains associated with increased kinase activity strongly suggesting oncogenic potential. Mutational analysis of previously unexamined tumors showed an amino acid change from
threonine
to alanine (T1025A) in exon 20 in one of 28 endometrial cancer samples and 6 endometrial cell lines. Additionally, a silent polymorphism (T1025T) was found in two of 20 MDS samples, one of 43 NHL samples, two of 40 osteosarcoma samples and Ishikawa. The polymorphism was established by identifying two of 92 normal samples with the same change. No PIK3CA mutations were found in acute myeloid leukemia (AML), myelodysplastic syndromes (MDS) and non-
Hodgkin
lymphomas (NHL) as well as in osteosarcomas, prostate and ovarian cancer samples. Additionally, a previously unidentified PIK3CA pseudogene spanning exons 9-13 on chromosome 22 was discovered.
...
PMID:Rare mutations of the PIK3CA gene in malignancies of the hematopoietic system as well as endometrium, ovary, prostate and osteosarcomas, and discovery of a PIK3CA pseudogene. 1676 26
The
Hodgkin
-Reed-Sternberg (HRS) malignant cells in
Hodgkin's lymphoma
(HL) originate from germinal center B lymphocytes that did not undergo apoptosis. Protein Kinase C (PKC), a family of serine/
threonine
kinases, plays a crucial role in signal transduction modulating cell growth, differentiation and apoptosis. Here, we report the expression of PKC isoforms in two HL-derived cell lines, L428 and KMH2 and their correlation with drug resistance to CPT and doxorubicin. Among the PKC isoforms examined, only PKCeta and PKCbetaII were preferentially expressed in the drug resistant L428 cells. We have shown correlation between the response to apoptosis of L428 and KMH2 cells and PKCeta expression in these cell lines. In order to directly demonstrate a role for PKCeta in apoptosis, its expression was knocked-down by siRNA in the resistant L428 cells. Downregulation of PKCeta rendered L428 cells more sensitive to doxorubicin and CPT. Furthermore, PKCeta knocked-down cells showed increased PARP-1 cleavage, cytochrome c release and caspase 7 activation. It appears that PKCeta functions as an anti-apoptotic protein in HL-derived cell lines, and as we show here that it is also expressed in HRS of HL biopsies, it may have therapeutic relevance in HL. Thus, PKCeta could provide a new target aimed to reduce resistance to anti-cancer treatments of HL and other cancer patients.
...
PMID:PKCeta expression contributes to the resistance of Hodgkin's lymphoma cell lines to apoptosis. 1778 31
Tumor necrosis factor (TNF) receptor-associated factor 2 (TRAF2) is an adaptor protein that modulates the activation of the c-Jun NH(2) terminal kinase (JNK)/c-Jun and IkappaB kinase (IKK)/nuclear factor-kappaB (NF-kappaB) signaling cascades in response to TNFalpha stimulation. Although many serine/
threonine
kinases have been implicated in TNFalpha-induced IKK activation and NF-kappaB-dependent gene expression, most of them do not directly activate IKK. Here, we report that protein kinase Czeta phosphorylates TRAF2 at Ser(55), within the RING domain of the protein, after TNFalpha stimulation. Although this phosphorylation event has a minimal effect on induction of the immediate/transient phase of IKK and JNK activation by TNFalpha, it promotes the secondary/prolonged phase of IKK activation and inhibits that of JNK. Importantly, constitutive TRAF2 phosphorylation increased both basal and inducible NF-kappaB activation and rendered Ha-Ras-V12-transformed cells resistant to stress-induced apoptosis. Moreover, TRAF2 was found to be constitutively phosphorylated in some malignant cancer cell lines and
Hodgkin's lymphoma
. These results reveal a new level of complexity in TNFalpha-induced IKK activation modulated by TRAF2 phosphorylation and suggest that TRAF2 phosphorylation is one of the events that are responsible for elevated basal NF-kappaB activity in certain human cancers.
...
PMID:Phosphorylation of TRAF2 within its RING domain inhibits stress-induced cell death by promoting IKK and suppressing JNK activation. 1933 68
mTOR (mammalian target of rapamycin) inhibitors were recently found to be effective in the treatment of various human non-
Hodgkin
's lymphomas (NHLs). We recently reported that RAD001, an mTOR inhibitor, suppressed the growth of lymphoma cells at concentrations much lower than those required for carcinomas. However, the basis for the enhanced sensitivity to RAD001 is unknown. Seven aggressive NHL cell lines and seven carcinoma cell lines were used in this study. Cell cycle was analysed by flow cytometry. pAKT (phosphorylated AKT) (Ser(473) and
Thr
(308)), p-p70S6K, p-4E-BP1, p-mTOR, p-eIF4E (phosphorylated eIF4E), cyclin A, cyclin E, cyclin D3, c-Myc and insulin receptor substrate-1 (IRS-1) protein expression were assessed by immunoblotting. The PI3K/AKT/mTOR (phosphatidylinositol 3-kinase/protein kinase B/mammalian target of rapamycin) signalling pathway was constitutively expressed in all seven lymphoma cell lines. RAD001 down-regulated p-mTOR, p-p70S6K, p-4E-BP1, cyclin A, cyclin E, cyclin D3, and c-Myc, but did not affect IRS-1. In parallel with RAD001-induced inhibition of cell viability, a dose- and schedule- dependent down-regulation of pAKT and p-eIF4E expressions was demonstrated. In contrast, a compensatory activation of pAKT and p-eIF4E, was observed in seven carcinoma cells. These findings indicate that the basis for enhanced activity of mTOR inhibitors in NHL may be the lack of compensatory activation of AKT and eIF4E phosphorylation in lymphoma cells.
...
PMID:Lack of compensatory pAKT activation and eIF4E phosphorylation of lymphoma cells towards mTOR inhibitor, RAD001. 2133 99
1
2
3
Next >>