Gene/Protein Disease Symptom Drug Enzyme Compound
Pivot Concepts:   Target Concepts:
Query: UMLS:C0019204 (hepatocellular carcinoma)
71,386 document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)

A mitochondrial aspartate tRNA (anticodon GUC) was isolated from a transplantable rat tumor, Morris hepatoma 5123D, and sequenced. The sequence, pGAGAUAUUm(1)AGUAAAAUAAUUACA psi AACCUUGUCAAGGUUAAGUUAUAGACUUAAAUCUAUAUAUCUUACCAOH, can be arranged in a cloverleaf structure. The RNA exhibits a number of unusual features, such as lack of the constant -G-G- and -T-psi-C- sequences in loops I and IV, respectively, small size of these loops, lack of the constant G.C base pair adjacent to loop IV, predominance of A.U base pairs in general, and presence of m1A in position 9. The RNA exhibits 82 and 70% homology with the DNA-derived putative sequences of human placenta and beef heart mitochondrial tRNA Asp, respectively, and bears little resemblance to other sequenced aspartate tRNAs of non-mitochondrial origin.
...
PMID:Tumor mitochondrial transfer ribonucleic acids: the nucleotide sequence of Morris hepatoma 5123D mitochondrial tRNA GUC Asp. 691 41

A fraction containing liver- and hepatoma-specific non-histone proteins has been isolated from the chromatin of mice. Amino acid analysis of this fraction shows that it contains 16 mol of glutamic acid, 10 mol aspartic acid, 7 mol of both arginine and lysine per 100 mol and contains no cysteine or tyrosine. The proteins in this fraction are strongly associated with DNA and are co-extracted with histones from chromatin with 0.25 M HCl. In chromatin from age-related hepatomas, the amount of this fraction increased six-fold. This increase in concentrations of these chromatin proteins may be associated with changes of chromatin structure necessary to initiate malignant growth in liver cells.
...
PMID:The characterization of non-histone proteins whose amounts increase in chromatin from mouse hepatocarcinomas. 711 99

Interleukin-6 (IL-6) triggers the formation of a high affinity receptor complex constituted by the ligand-binding subunit IL-6 receptor alpha (IL-6R alpha) and the signal-transducing beta chain gp130. Since the cytoplasmic region of IL-6R alpha is not required for signal transduction, soluble forms of IL-6R alpha (sIL-6R alpha) show agonistic properties because they are still able to originate IL-6.sIL-6R alpha complexes, which in turn associate with gp130. A three-dimensional model of the human IL-6.IL-6R alpha.gp130 complex has been constructed and verified by site-directed mutagenesis of regions in shIL-6R alpha (where "h" is human) anticipated to contact hgp130, with the final goal of generating receptor variants with antagonistic properties. In good agreement with our structural model, substitutions at Asn-230, His-280, and Asp-281 selectively impaired the capability of shIL-6R alpha to associate with hgp130 both in vitro and on the cell surface, without affecting its affinity for hIL-6. Moreover, the multiple substitution mutant A228D/N230D/H280S/D281V expressed as a soluble protein partially antagonized hIL-6 bioactivity on hepatoma cells.
...
PMID:Interleukin-6 (IL-6) antagonism by soluble IL-6 receptor alpha mutated in the predicted gp130-binding interface. 774 75

Infection with hepadnaviruses and exposure to dietary aflatoxin are considered major risk factors in the development of hepatocellular carcinoma (HCC) both in humans and in animals. Recently, a broad range of mutations in the p53 tumor suppressor gene has been reported in human HCCs, predominantly from hepatitis B virus carriers in areas with either high or low levels of exposure to dietary aflatoxin. To determine whether p53 mutations are common to HCCs of hosts infected with related hepadnaviruses with and without treatment with aflatoxin, we studied the occurrence of mutations in the p53 gene in HCCs of ground squirrels and woodchucks with history of infection with ground squirrel hepatitis virus (GSHV) and woodchuck hepatitis virus, respectively. Sequencing of wild type p53 genes from ground squirrels and woodchucks revealed remarkable homology between the two species with only a few amino acid differences in exons 4, 8, and 9. Using direct polymerase chain reaction sequencing, we analyzed the state of the p53 gene (exons 4-9) in 20 HCCs from ground squirrels (2 uninfected, 7 with past, and 11 with ongoing infection with GSHV) and in 11 HCCs from woodchucks persistently infected with woodchuck hepatitis virus. Five GSHV carrier and two uninfected ground squirrels received i.p. administration of aflatoxin B1. We detected only one mutation in the p53 gene of the tested animals. This mutation was located in codon 176 of exon 5 in the HCC of a GSHV-positive ground squirrel treated with aflatoxin. Mutation was caused by a G to T transversion in the second position of the codon, resulting in the replacement of cysteine with phenylalanine, and was accompanied by a tumor-specific loss of heterozygosity. p53 allelic amino acid variation with sequences coding for aspartic acid or asparagine was present in codon 61 in the variable region of exon 4 in both HCCs and nonneoplastic tissues of ground squirrels. In view of the considerably lower apparent rate of mutations in comparison to human HCCs, we suggest a less important role for aflatoxin in the induction of p53 mutations in HCCs of ground squirrels. Alternatively, etiological factors other than p53 mutations may be of greater significance in the development of HCC in ground squirrels and woodchucks.
...
PMID:State of the p53 gene in hepatocellular carcinomas of ground squirrels and woodchucks with past and ongoing infection with hepadnaviruses. 792 76

A patient with liver cirrhosis who progressed to hepatocellular carcinoma was found to develop novel antinuclear antibodies. The serum was used to isolate full-length cDNA clones encoding related proteins of 530 amino acids (representative clone HCC1.4) and 524 amino acids (representative clone HCC1.3). Affinity-purified antibodies eluted from recombinant proteins recognized a 64-kD nuclear protein in Western blotting and decorated the nucleoplasm in a speckled-network fashion in immunofluorescence, colocalizing with antibodies to pre-mRNA splicing factor SC35 and uridine-rich small nuclear RNAs. The deduced amino acid sequence contained an arginine/serine-rich (RS) domain and three-ribonucleoprotein consensus sequence domains, two classes of motifs present in several splicing factors. A repeating octapeptide of Arg-Ser-Arg-Ser-Arg(Lys)-Glu(Asp)-Arg-Lys(Arg) was present in RS region of HCC1. This octapeptide sequence called RS-ERK motif was also found in splicing factors U2AF 35- and 65-kD proteins and 70-kD U1 small nuclear ribonucleoprotein. The molecular features and immunolocalization data suggest that the HCC1 autoantigen may be associated with splicing activities and are consistent with observations that autoantibody responses frequently target molecules involved in important cellular biosynthetic functions.
...
PMID:Novel nuclear autoantigen with splicing factor motifs identified with antibody from hepatocellular carcinoma. 822 58

The interaction of tumor cells with extracellular matrix components such as laminin, fibronectin, and collagen has been shown to be mediated through a family of cell-surface receptors that specifically recognize an arginine-glycine-aspartic acid amino acid sequence within each protein. Triflavin, a 7.5 kDa cysteine-rich polypeptide purified from Trimeresurus flavoviridis snake venom, belongs to a family of arginine-glycine-aspartic acid-containing peptides termed disintegrins that have been isolated from the venoms of various vipers and shown to be potent inhibitors of platelet aggregation. In this study, we showed that triflavin inhibited adhesion of human hepatoma J-5 cells to extracellular matrices (fibronectin, vitronectin, fibrinogen, and collagen type I) in a dose-dependent manner. On the other hand, triflavin exerted a limited inhibitory effect on cell attachment to collagen type IV and laminin (< or = 40%). Triflavin is approximately 1000 times more potent than glycine-arginine-glycine-aspartic acid-serine at inhibiting cell adhesion. When immobilized on plate, triflavin promoted J-5 cell attachment; this attachment was inhibited by glycine-arginine-glycine-aspartic acid-serine. In addition, triflavin labeled with iodine 125 binds to J-5 cells in a saturable manner and its binding was also inhibited by glycine-arginine-glycine-aspartic acid-serine. Its Kd value was estimated to be 3.9 x 10(-7) mol/L and the number of binding sites was around 60,000 per cell. Furthermore, triflavin did not affect tritiated thymidine uptake during a 3-day incubation.(ABSTRACT TRUNCATED AT 250 WORDS)
...
PMID:Triflavin, an antiplatelet peptide, inhibits tumor cell-extracellular matrix adhesion through an arginine-glycine-aspartic acid-dependent mechanism. 830 Dec 2

Three forms of interleukin-6 (IL-6) have been constructed and stably transfected into human hepatoma cells (HepG2). Wild type IL-6 containing a signal peptide was rapidly secreted as a biologically active protein. IL-6 lacking the signal peptide accumulated within the cytoplasm of transfected cells. Surprisingly, IL-6 carrying a COOH-terminal extension of the amino acids Lys-Asp-Glu-Leu (KDEL) was not completely retained in the endoplasmic reticulum (ER). Complete retention in the ER was achieved when the 14 COOH-terminal amino acids of protein disulfide isomerase which include the KDEL signal were added to the COOH terminus of IL-6. This finding clearly demonstrates that the addition of the protein sorting signal KDEL alone is not sufficient for full retention of IL-6 in the ER. IL-6 accumulated in the cytoplasm and IL-6 retained in the ER failed to induce liver-specific acute-phase protein synthesis in the host cells, indicating that there is no intracellular role for IL-6 in signal transduction. Retention of IL-6 in the ER led to the prevention of surface expression of the IL-6 receptor protein gp80, making these cells unresponsive to IL-6. This phenomenon can be exploited in the future to generate transgenic animals which will become completely cytokine unresponsive in the tissues in which they express an ER retained cytokine.
...
PMID:Intracellular retention of interleukin-6 abrogates signaling. 840 66

The eukaryotic initiation factor 2 (eIF-2)-associated 67-kDa glycoprotein (p67) protects eIF-2 alpha-subunit from inhibitory phosphorylation by eIF-2 kinases, such as heme-regulated inhibitor and double-stranded RNA-activated inhibitor. This promotes protein synthesis in the presence of eIF-2 kinases present in animal cells (Ray, M. K., Datta, B., Chakraborty, A., Chattopadhyay, A., Meza-Keuthen, S., and Gupta, N. K. (1992) Proc. Natl. Acad. Sci. U.S.A. 89, 539-543). In this study, the primary structure of rat p67 is determined by cDNA cloning. Based on the partial amino acid sequences of overlapping tryptic and cyanogen bromide cleaved fragments, degenerate oligonucleotides were synthesized and used as primers for the polymerase chain reaction to amplify the corresponding p67 cDNA fragment from rat liver first strand cDNA. The amplified DNA was then used as a probe to screen a rat tumor hepatoma (KRC-7) cDNA library, and a positive clone covering the entire coding region was obtained. From the cDNA sequence, an open reading frame that encodes p67 as a 480-amino acid protein with a molecular mass of 53 kilodaltons was predicted for the unglycosylated protein. The cloned cDNA was further characterized by in vitro transcription-coupled translation in micrococcal nuclease-treated reticulocyte lysate. The translated product migrated similarly to p67 in SDS-polyacrylamide gel electrophoresis and was precipitated with antibodies against p67. Northern blot analysis of rat liver poly(A)+ RNA showed a single size class (approximately 2 kilobases) of mRNA. The deduced amino acid sequence of the protein showed a highly charged N-terminal region composed of two basic polylysine blocks and an acidic aspartic acid block. The protein also exhibits significant sequence identity in the N-terminal region with human eIF-2 beta-subunit.
...
PMID:Cloning and characterization of complementary DNA encoding the eukaryotic initiation factor 2-associated 67-kDa protein (p67). 849 45

We have developed a useful strategy for identifying amino acid spin systems and side-chain carbon resonance assignments in small 15N-, 13C-enriched proteins. Multidimensional constant-time pulsed field gradient (PFG) HCC(CO)NH-TOCSY experiments provide side-chain resonance frequency information and establish connectivities between sequential amino acid spin systems. In PFG HCC(CO)NH-TOCSY experiments recorded with a properly tuned constant-time period for frequency labeling of aliphatic 13C resonances, phases of cross peaks provide information that is useful for identifying spin system types. When combined with 13C chemical shift information, these patterns allow identification of the following spin system types: Gly, Ala, Thr, Val, Leu, Ile, Lys, Arg, Pro, long-type (i.e., Gln, Glu and Met), Ser, and AMX-type (i.e., Asp, Asn, Cys, His, Phe, Trp and Tyr).
...
PMID:Classification of amino acid spin systems using PFG HCC(CO)NH-TOCSY with constant-time aliphatic 13C frequency labeling. 858 9

In many cancers, inactivating mutations in both alleles of the transforming growth factor beta (TGF-beta) type 11 receptor (TbetaRII) gene occur and correlate with loss of sensitivity to TGF-beta. Here we describe a novel mechanism for loss of sensitivity to growth inhibition by TGF-beta in tumor development. Mac-1 cells, isolated from the blood of a patient with an indolent form of cutaneous T-cell lymphoma, express wild-type TbetaRII and are sensitive to TGF-beta. Mac-2A cells, clonally related to Mac-1 and isolated from a skin nodule of the same patient at a later, clinically aggressive stage of lymphoma, are resistant to TGF-beta. They express both the wild-type TbetaRII and a receptor with a single point mutation (Asp-404-Gly [D404G]) in the kinase domain (D404G-->TbetaRII); no TbetaRI or TbetaRII is found on the plasma membrane, suggesting that D404G-TbetaRII dominantly inhibits the function of the wild-type receptor by inhibiting its appearance on the plasma membrane. Indeed, inducible expression, under control of a tetracycline-regulated promoter, of D404G-TbetaRII in TGF-beta- sensitive Mac-1 cells as well as in Hep3B hepatoma cells results in resistance to TGF-beta and disappearance of cell surface TbetaRI and TbetaRII. Overexpression of wild-type TbetaRII in Mac-2A cells restores cell surface TbetaRI and TbetaRH and sensitivity to TGF-beta. The ability of the D404G-TbetaRH to dominantly inhibit function of wild-type TGF-beta receptors represents a new mechanism for loss of sensitivity to the growth-inhibitory functions of TGF-beta in tumor development.
...
PMID:A dominant inhibitory mutant of the type II transforming growth factor beta receptor in the malignant progression of a cutaneous T-cell lymphoma. 866 64


<< Previous 1 2 3 4 5 6 7 8 9 10 Next >>