Gene/Protein Disease Symptom Drug Enzyme Compound
Pivot Concepts:   Target Concepts:
Query: UMLS:C0006142 (breast cancer)
160,383 document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)

The RNase-resistant and membrane-permeable antisense poly-2'-O-(2,4-dinitrophenyl)-oligoribonucleotides (poly-DNP-RNA) against RIalpha subunit of protein kinase A (RIalpha/PKA) has been used to inhibit the growth of human breast cancer MDA-MB-231 cells in vitro and in vivo. This antisense poly-DNP-RNA, with oligonucleotide sequence GGGCGUGCCUCCUCACUGGC, was found to be an effective concentration-dependent inhibitor of MDA-MB-231 cell line, whereas the control poly-DNP-RNAs with either random or sense sequence were found completely inactive. In situ hybridization studies showed that this antisense inhibitor can permeate spontaneously into MDA-MB-231 cells and distribute itself throughout the cytoplasm. Intraperitoneal administration of this antisense RIalpha poly-DNP-RNA to SCID mice with transplanted MDA-MB-231 cells was found to inhibit the growth of the xenografts in a concentration-dependent way, prevent metastasis, and drastically reduce mortality.
...
PMID:Growth inhibition and antimetastatic effect of antisense poly-DNP-RNA on human breast cancer cells. 1090 62

HER-2/neu is overexpressed on a variety of human adenocarcinomas and overexpression has been associated with a poor prognosis. For this reason, HER-2 has become an attractive target for immunotherapy. To facilitate testing of anti-HER-2-monoclonal antibodies (MAbs) and immunotoxins (ITs), we have evaluated the in vivo growth and metastatic spread of three HER-2-overexpressing human breast cancer cell lines (BT474, MDA-MB-453 and HCC1954) and one ovarian cancer cell line (SKOV3.ip1) in pre-irradiated male SCID mice using subcutaneous (s.c.), intravenous (i.v.) and intraperitoneal (i.p.) routes of injection. All the cell lines tested grew as s.c. tumors and the growth of BT474 and MDA-MB-453 cells after s.c. injection was improved by co-inoculation with Matrigel. Metastases to the lungs were detectable by PCR or histopathology after s.c. injection of BT474 and to a much lesser extent after s.c. injection of HCC1954, MD-MB-453 and SKOV3.ip1 cells. I.p. injection of HCC1954 and SKOV3.ip1 cells produced fatal ascites while i.v. injection of SKOV3.ip1, but not BT474 or MDA-MB-453 cells, resulted in infiltration of lungs and death within 9-11 weeks.
Breast Cancer Res Treat 2000 Jun
PMID:The growth and metastasis of human, HER-2/neu-overexpressing tumor cell lines in male SCID mice. 1096 98

Platelet-activating factor (PAF), a phospholipid mediator of inflammation, is present in breast cancer tissue and correlates with microvessel density. In the present study, we investigated the biological significance of PAF synthesized within breast cancer. In vitro, we observed the production of PAF by two estrogen-dependent (MCF7 and T-47D) and an estrogen-independent (MDA-MB231) breast cancer cell lines after stimulation with vascular endothelial growth factor, basic fibroblast growth factor, hepatocyte growth factor, tumor necrosis factor, thrombin but not with estrogen, progesterone, and oxytocin. The sensitivity to agonist stimulation and the amount of PAF synthesized as cell-associated or released varied in different cell lines, being higher in MDA-MB231 cells, which are known to be highly invasive. We further demonstrate, by reverse transcriptase-polymerase chain reaction and cytofluorimetry, that all of the breast cancer cells express the PAF receptor and respond to PAF stimulation in terms of proliferation. Moreover, in MDA-MB231 cells PAF elicited cell motility. In vivo, two structurally different PAF receptor antagonists WEB 2170 and CV 3988 significantly reduced the formation of new vessels in a tumor induced by subcutaneous implantation of MDA-MB231 cells into SCID mice. In conclusion, these results suggest that PAF, produced and released by breast cancer cells, can contribute to tumor development by enhancing cell motility and proliferation and by stimulating the angiogenic response.
...
PMID:PAF produced by human breast cancer cells promotes migration and proliferation of tumor cells and neo-angiogenesis. 1107 30

The c-erbB-2 product is thought to be a unique and useful target for antibody therapy of cancers that overxpress the c-erbB-2 gene. Its overexpression is also speculated to be correlated with chemoresistance to doxorubicin. The in vitro and in vivo anti-tumor effects of a humanized antibody directed against the extracellular domain of the c-erbB-2 gene product, rhu4D5, were examined. Rhu4D5 had direct antiproliferative activity against the SK-BR-3 cell line which overexpresses c-erbB-2. The in vivo treatment, using rhu4D5, of SCID mice carrying xenografts of 4-1ST human gastric carcinoma, which overexpresses c-erbB-2, revealed that the recombinant protein had potent anti-tumor activity. Furthermore, the cytotoxic action of human peripheral blood mononuclear cells against the SK-BR-3 cell line was significantly augmented with the administration of rhu4D5, but not with mu4D5. These results indicate that rhu4D5 might be a more efficacious treatment than previously predicted by preclinical studies.
Breast Cancer 1997 Dec 25
PMID:A Humanized Anti-c-erbB-2 Monoclonal Antibody for the Treatment of Breast Cancer. 1109 13

While some epidemiological risk factors for breast cancer have been identified, the environmental factors responsible for transformation of mammary epithelial cells are not clear. We have exposed the spontaneously immortalized human mammary epithelial cell line MCF-10A to benzo[a]pyrene and selected transformed clones based on a loss of contact inhibition and anchorage-dependent growth. Cytogenetic studies showed that each of the transformed sublines possess an isochromosome 8q aberration. The c-Myc proto-oncogene, which is positioned at 8q24, was analyzed for changes in expression. Both c-Myc mRNA and protein levels were increased in the transformed clones relative to the parental cells. The transformed clones were not able to grow as tumors in vivo when injected into nude or SCID mice. To determine whether the involvement of chromosome 8 in BP-induced mutagenesis was a reproducible event, transformed clones were selected from three additional independently treated sets of BP-exposed MCF-10A cultures and analyzed by spectral karyotyping (SKY). These transformed sublines also harbored the isochromosome 8q abnormality. Data from this model show that benzo[a]pyrene, a ubiquitous procarcinogen, can induce selectable morphologic changes in a human mammary epithelial cell line, and that these transformed cells possess chromosomal aberrations frequently found in human breast tumors.
...
PMID:Genetic alteration of chromosome 8 is a common feature of human mammary epithelial cell lines transformed in vitro with benzo[a]pyrene. 1116 28

The progression of breast cancer depends on the establishment of a neovasculature, by a process called angiogenesis. Angiogenesis is an invasive cellular event that requires the co-ordination of numerous molecules including growth factors and their receptors, extracellular proteins, adhesion molecules, and proteolytic enzymes. TGFbeta has emerged to be a major modulator of angiogenesis by regulating endothelial cell proliferation, migration, extracellular matrix (ECM) metabolism, and the expression of adhesion molecules. It is a potent growth inhibitor of normal mammary epithelial cells and a number of breast cancer cell lines. It seems that TGFbeta exerts pleiotropic effects in the oncogenesis of breast cancers in a contextual manner, i.e., it suppresses tumourigenesis at an early stage by direct inhibition of angiogenesis and tumour cell growth. However, over-production of TGFbeta by an advanced tumour may accelerate disease progression through indirect stimulation of angiogenesis and immune suppression. The cell membrane antigen CD105 (endoglin) binds TGFbeta1 and TGFbeta3 and is preferentially expressed in angiogenic vascular endothelial cells. The reduction of CD105 levels in HUVEC leads to in vitro angiogenesis inhibition and massive cell mortality in the presence of TGFbeta1. CD105 null mice die in utero with impaired vasculature, indicating the pivotal role of CD105 in vascular development. The administration of an immunotoxin-conjugate, mab to CD105, induces long-term and complete regression of breast cancer growth in SCID mice. Therefore, CD105 is a promising vascular target for antiangiogenic therapy.
...
PMID:Angiogenesis in breast cancer: the role of transforming growth factor beta and CD105. 1117 Mar 3

In an analysis of 84 primary-operated breast cancer patients and 11 healthy donors, we found that the bone marrow of most patients contained memory T cells with specificity for tumor-associated antigens. Patients' bone marrow and peripheral blood contained CD8+ T cells that specifically bound HLA/peptide tetramers. In short-term culture with autologous dendritic cells pre-pulsed with tumor lysates, patients' memory T cells from bone marrow (but not peripheral blood) could be specifically reactivated to interferon-gamma-producing and cytotoxic effector cells. A single transfer of restimulated bone-marrow T cells into NOD/SCID mice caused regression of autologous tumor xenotransplants associated with infiltration by human T cells and tumor-cell apoptosis and necrosis. T cells from peripheral blood showed much lower anti-tumor reactivity. Our findings reveal an innate, specific recognition of breast cancer antigens and point to a possible novel cancer therapy using patients' bone-marrow-derived memory T cells.
...
PMID:Therapy of human tumors in NOD/SCID mice with patient-derived reactivated memory T cells from bone marrow. 1128 72

The azonafides are a series of anthracene-based DNA intercalators which inhibit tumor cell growth in vitro at low nanomolar concentrations and are not affected by the multidrug resistance phenomenon (MDR). Prior studies have described antitumor efficacy in murine tumor models including L-1210 and P-388 leukemias, and B-16 melanoma. The current results extend these cell line observations to human tumors tested in the NCI panel of 56 cell lines, in freshly isolated tumors tested in colony-forming assays in soft agar and in several animal models. In the NCI panel, the overall mean 50% cell kill (LC50) for the unsubstituted azonafide, AMP-1, was 10(-5.53) M, with some selectivity noted in melanomas (10(-6.22) M). The mean LC50 for the 6-ethoxy substituted analog, AMP-53, was 10(-5.53) M, with some selectivity found in non-small cell lung cancer (10(-5.91)) and renal cell carcinoma (10(-5.84)). In freshly isolated human tumors tested in soft agar, there was marked activity (mean IC50 in microg/ml) for AMP-53 in four cell types: breast cancer (0.09), lung cancer (0.06), renal cell carcinomas (0.06) and multiple myeloma (0.03). These effects were superior to doxorubicin and to several other azonafides, including AMP-1, AMP-104 and the 6-hydroxyethoxy derivative, AMP-115. Compound AMP-1 was shown to be superior to amonafide in the mammary 16C breast cancer model in B6CF31 mice, but it had little activity in Colon-38 nor in M5076 ovarian sarcomas in vivo. Nine azonafides were evaluated in the Lewis lung cancer model in C57/bl mice, but only AMP-53 demonstrated significant efficacy with a treated/control x 100% (T/C) value of 30%. Because AMP-53 demonstrated the greatest breadth of activity, it was then evaluated in several human tumor cell lines growing in mice with severe combined immunodeficiency disease (SCID). Only three tumors were sensitive (T/C<42%), including HL-60 leukemia (T/C=39%), MCF-7 breast cancer (T/C=39%) and A549 non-small cell lung cancer (T/C=37%). Overall, these results demonstrate that the 6-ethoxy substituted azonafide, AMP-53, has consistent (in vitro and in vivo) experimental antitumor activity in human breast and lung cancer, and could be considered for clinical testing in patients with MDR tumors.
...
PMID:Preclinical antitumor activity of the azonafide series of anthracene-based DNA intercalators. 1129 Aug 69

The neoplastic conversion of a normal cell to a malignant one is a multistage process that occurs after a series of molecular alterations. Several chemical and physical agents can alter the morphology of different types of cells. Scanning and transmission electron microscopy have been valuable in evaluating changes that occur in the progression of transformation. MCF-10F, a spontaneously immortalized human breast epithelial cell line (Soule et al., 1990), was treated with benz(alpha)pyrene (BP) (Calaf and Russo, 1993) and then transfected with the c-Ha-ras oncogene (Calaf et al., 1995). The phenotypic changes of breast cancer progression were studied through the use of scanning and transmission electron microscopy. Activated oncogenes have been detected in a variety of malignant tumors and the altered expression of certain genes seems to play a role in the cancer process. Carcinogen-treated and transfected cells showed a progression of changes in the morphology, anchorage independent growth, invasiveness and capability of tumor formation in the SCID mice. This in vitro cancer model can parallel the progression of breast cancer seen through molecular changes that occur and have been observed during the natural development of this disease.
...
PMID:Morphological phenotypes in neoplastic progression of benz(alpha)pyrene-treated breast epithelial cells. 1129 72

Bispecific antibodies are currently being used in clinical trials in increasing numbers in the areas of breast cancer, prostate cancer, non-Hodgkin's lymphoma and Hodgkin's lymphoma. We have previously performed two clinical trials in patients with Hodgkin's disease with an anti-CD30/anti-CD16 bispecific antibody and demonstrated a 30% response rate in a cohort of patients otherwise resistant to standard therapeutic modalities. However, no surrogate marker could be defined in these trials indicative of optimal antibody dosing/scheduling or predictive for favorable response. In order to evaluate accurately the potential biodistribution properties of bispecific antibody in patients, we have performed a detailed analysis of the binding properties and animal model in vivo characteristics of these constructs. For this purpose, the parental antibodies (anti-CD30 and anti-CD16) and the bispecific antibody (anti-CD30/anti-CD16) were radiolabeled with either 125I or 111In. Antibody integrity and binding properties after labeling were confirmed by Scatchard plot and Lindmo analysis. 111In-labeled antibodies revealed superior targeting properties in a standard SCID mouse tumor model. Both the bivalent parental anti-CD30 monoclonal antibody and the monovalent anti-CD30/anti-CD16 bispecific antibody showed excellent uptake in CD30+ tumors which did not differ significantly between the two (maximum uptake 16.5%+/-4.2% vs. 18.4%+/-3.8% injected dose/gram tissue). The equivalent targeting properties of the bispecific antibody compared with the parental anti-CD30 antibody encourages the further clinical development of this bispecific antibody, and might help to explain the clinical responses seen with this antibody so far in patients suffering from Hodgkin's disease.
...
PMID:Targeting properties of an anti-CD16/anti-CD30 bispecific antibody in an in vivo system. 1140 Oct 24


<< Previous 1 2 3 4 5 6 7 8 9 10 Next >>