Gene/Protein Disease Symptom Drug Enzyme Compound
Pivot Concepts:   Target Concepts:
Query: KEGG:D03374 (Capsicum)
 2,272 document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)

In Cinchona robusta (Rubiaceae) cell suspension cultures, the activity of the enzyme isopentenyl-diphosphate isomerase (isopentenyl-POP isomerase) is transiently induced after addition of a homogenate of the phytopathogenic fungus Phytophthora cinnamomi. The enzyme catalyses the interconversion of isopentenyl-POP and dimethylallyl diphosphate (dimethylallyl-POP) and may be involved in the biosynthesis of anthraquinone phytoalexins that accumulate rapidly after elicitation of Cinchona cells. From elicitor-treated C. robusta cells, two isoforms of isopentenyl-POP isomerase have been purified to apparent homogeneity in four chromatographic steps. The purified forms are monomeric enzymes of 34 kDa (isoform I) and 29 kDa (isoform II), with Km values for isopentenyl-POP of 5.1 microM and 1.0 microM, respectively. Both isoforms require Mn2+ or Mg2+ as cofactor, isoform II showing a preference for Mn2+ with maximum activity at 1.5-2 mM. Isoform I was most active in the presence of 0.5-1.5 mM Mg2+ or in the presence of 0.5 mM Mn2+. A pH optimum of 7-7.8 was found for both forms and both were competitively inhibited by geranyl diphosphate (Ki 96 microM for isoform I) and the transition state analogue 2-(dimethylamino)ethyl diphosphate. Rechromatography of purified isoforms did not indicate any interconversion of both forms. Western blot analysis, using antibodies raised against isopentenyl-POP isomerase purified from Capsicum annuum, showed the presence of both isoforms in the crude protein extracts from C. robusta cells. Isoform II was specifically induced by elicitation, non-treated cells contained low activity of this isoform. The possible role of isopentenyl-POP isomerase in the biosynthesis of anthraquinones is discussed.
 ...
PMID:Purification and characterization of two isoforms of isopentenyl-diphosphate isomerase from elicitor-treated Cinchona robusta cells. 936 68

The Dominican Republic has a significant area of the country cultivated with vegetables. In July 2013, in the provinces of Moca and La Vega, horticultural crops showed typical tospovirus symptoms (>30% incidence), including bronzing, chlorosis, necrosis, and ring spots on leaves and fruits. Samples were collected from potatoes (Solanum tuberosum), long beans (Vignaun guiculata), chili peppers (Capsicum frutescens), sweet peppers (C. annuum), and tomatoes (S. lycopersicum). Serological tests were clearly positive for infection by Tomato spotted wilt virus (TSWV) and/or related tospoviruses when tested with AgDia immunostrips. The viral RNA extracted from five plants per host was pooled to construct a cDNA library that was sequenced using an Illumina HiSeq 2000 platform. The paired-end reads were assembled using CLC Genomic Workbench version 6.0.3. The assembled contigs were submitted to BLASTx against a viral genome database. The results confirmed the presence of Tomato chlorotic spot virus (TCSV) and TSWV. Then, PCR tests were performed with primers pairs TSWV-LF 5' CTGTTGTCTATTGAGGATTGTG 3' AND TSWV-LR 5' CAGAGAGCTTGTTAATGCAGGAC 3' to amplify part of the TSWV L RNA, the pairs TCSV-SF 5' AACTGGGAAAGCAGAAAACC 3' and TCSV-SR 5' CCTTACTCCGAACATTGCA 3', and GRSV-SF 5' CTGTCAGGAAAATCTTGACCTG 3' and GRSV-SR 5' CTTGACTCCAAACATCTCGT 3' to detect part of the TCSV and Groundnut ringspot virus (GRSV) S segments. In the long bean and chili pepper samples from La Vega, only TCSV was detected (40% of the all samples) based on amplification of the expected size fragment with the S RNA specific primer pair. All the other samples were positive for TSWV and no GRSV was detected. The complete N gene of TCSV and TSWV were amplified using the primer pairs TCSV-NR2 5' CACACTGAACTGAACTATAACACAC 3' and TCSV-NF 5' ACCTTGAATCATATCTCTCG 3' and primers N-TSWV_FW 5' TACGGATCCGATGTCTAAGGTTAAGCTCAC 3' and N-TSWV_RV 5' TTATCTCGAGTCAAGCAAGTTCTGCGAG 3'. The TCSV N protein sequences (KJ399303 and KJ399304) were 99% identical with the TCSV found in processing tomatoes in the Dominican Republic (1) and the United States (2). The TSWV N protein sequences (KJ399313, KJ399314 and KJ399315) shared 96 to 98% identity with the TSWV N sequences available. Dot blot hybridization tests (1) using DIG-labeled specific TCSV N gene probe confirmed TCSV infection in PCR-positive long bean and chili pepper samples, whereas no hybridization signal was detected for TSWV-infected tomatoes, potatoes, sweet peppers, or healthy samples. In addition, no reassortants were detected based on amplification of the expected size RNA fragments (3). These other amplicons (KJ399301, KJ399299, KJ399302, and KJ399300) showed 98% identity with the L and M segments of TCSV. Thrips collected from symptomatic plants were identified mainly as Frankliniella schultzei, consistent with the main thrips species transmitting TCSV. In the last two years, TCSV was reported in North and Central America and in the Caribbean Basin (1,2,4). These findings have an important epidemiological impact since TCSV represents a new threat to other horticultural crops affected by this tospovirus. References: (1) O. Batuman et al. Plant Dis. 98:286, 2014. (2) A. Londono et al. Trop. Plant Pathol. 37:333, 2012. (3) C. G. Webster et al. Virology 413:216, 2011. (4) C. G. Webster et al. Plant Health Progress. Online publication. doi:10.1094/PHP-2013-0812-01-BR, 2013.
 ...
PMID:The First Report of Tomato chlorotic spot virus (TCSV) Infecting Long Beans and Chili Peppers in the Dominican Republic. 3069 39

Chili pepper (Capsicum annuum L.) is one of the most important spice crops in India. In October of 2006, symptoms indicative of tospovirus infection were noticed in several commercial fields of chili pepper near Bangalore in Karnataka State. Chlorotic and necrotic spots and rings on leaves, apical necrosis, and leaf distortion were observed. Disease incidence was more than 20%. Mechanical inoculation with sap extracts from these symptomatic plants showed that the host range and symptomatology of the virus was similar to those described for Capsicum chlorosis virus (CaCV) (1,3). The virus reacted with antisera specific to Groundnut bud necrosis virus (GBNV) and Watermelon silver mottle virus of serogroup IV tospoviruses in antigen-coated plate ELISA. It did not react with antisera specific to Tomato spotted wilt virus, Impatiens necrotic spot virus, or Iris yellow spot virus in double-antibody sandwich-ELISA. Immunosorbent electron microscopy of infected sap using GBNV antiserum revealed the presence of strongly decorated quasi-spherical virus particles. Reverse transcription (RT)-PCR was conducted to further identify the virus. No amplification was observed from extracts of symptomatic plants (n = 10) by RT-PCR using GBNV-specific primers (4), indicating that the diseased chili was not infected with GBNV. However, a DNA fragment of approximately 850 bp was amplified by using primers specific to the nucleocapsid (N) gene of CaCV (CaCF 5'-CTATAGAWGTACTAGGCTTTGAGC-3' and CaCR 5'-CATGTCTAACGTCAGGCAACTTAC-3'). Direct sequencing of the amplicon (GenBank Accession No. EF625227) revealed a nucleotide sequence identity ranging from 85.5% with isolates from Thailand (GenBank Accession Nos. AY846366, AY647437, and AF134400) and China (GenBank Accession No. DQ355974) to 98.1% with isolates from Australia (GenBank Accession Nos. AY036057 and AY036058). Phylogenetic analysis of the N protein sequences showed that the chili pepper isolate from India formed a cluster with those from Australia. This cluster was distinct from the one formed by the peanut isolates from Thailand and a tomato isolate from India (2). To our knowledge, this is the first report of CaCV infection of chili pepper in India. The potential impact of CaCV on tomato and chili pepper production in India remains to be seen. References: (1) D. Knierim et al. Arch. Virol. 90:377, 2006. (2) S. Kunkalikar et al. Online publication. doi:10.1094/PHP-2007-1204-01-BR. Plant Health Progress, 2007. (3) L. A. Mc Michael et al. Aust. Plant Pathol. 31:231, 2002. (4) K. Umamaheswaran et al. Indian Phytopathol. 56:168, 2003.
 ...
PMID:Capsicum chlorosis virus (Genus Tospovirus) Infecting Chili Pepper (Capsicum annuum) in India. 3076 43